. Home . Commission Members . Meetings . Newsletters . Forum . Electronic magazines . Commission publications . Forum archive . International Union of Soil Science . Commission on Paleopedology . International Union for Quaternary Research . Subcommission on Paleopedology . IUSS . << RERUM COGNOSCERE CAUSAS .

Еще в разделе: (Показать все результаты (>5) - www.paleopedology.msu.ru/ )

. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . news . Panasyuk M. (SINP, Russia). Relec . Klimov S. (ISR, Russia). Wave Research... (SINP, Russia). Relec 1th results . Bogomolov V., Iudin A. (SINP, Russia). Relec TGF-GRB . Bogomolov A., Myagkova I. (SINP, Russia). Hi-energy electrons research...

Еще в разделе: (Показать все результаты (>2) - vernov-relec.sinp.msu.ru/ )

... 110 , ( l ) 400 . ... WEB-. ... Avt_1 Avt_2, , , ­ 5°. ... Avt_1, Avt_2, TV ,WEB_1 WEB_2) 2008 . ... Avt_1. ... Avt_2 Avt_1, , , Avt_1. Avt_2 2008 . ... 5 TV-, 22 6 2009 312 . ... 8 WEB-2 ( ± 0°.172), , . ... 2008 2009 ( ) , .. ... Saxl E.J., Allen M. 1970 solar eclipse as "seen" by to rsion pendulum // Phys. Rev., v. D 3, p. 823 - 825, 1971 8. Kuusela T. Effect of the solar eclipse on the period of a torsion pendulum // Phys. Rev., v. D 43, p. 2041 - 2043, 1991. ... WEB-2 17 23 2009 9. ...

Еще в разделе: (Показать все результаты (>418) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/saniga_psychopathological.pdf
• http://temporology.bio.msu.ru/EREPORTS/GCP.Events.Mar08.prepress.pdf
• http://temporology.bio.msu.ru/EREPORTS/levich_deter_analysis_in/Maksim_e.pdf

... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...

Еще в разделе: (Показать все результаты (>10) - en.fbb.msu.ru/ )

• Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University

... Classification of the engineering geological Earth's structures and their characteristic (Project manager – Prof. Trofimov V.T.; investigator – Ass. ... Artificial soils as a result of technogenesis (Project manager - Prof. Trofimov V.T.; investigator - Ass. ... Tgheoretical problems of evolution of engineering geological Earth's conditions at the epoch of technogenesis (Project manager - Prof. Trofimov V.T.; investigator – Senior Research Worker Kyrinov M.B.); . ... Project manager . ... 1998-2000 ...

Еще в разделе: (Показать все результаты (>88) - www.geol.msu.ru/ )

• Faculty of Geology >> Our adjunct Professors
• Faculty of Geology >> Geology at Moscow State University

... trans "Lomonosov Moscow State University" %} Sternberg Astronomical Institute . ... Seminar archive . ... Seminar archive 2014 26 December . ... Одно из первых цветных фото, полученных на новом телескопе: http://www.saao.ac.za/spod/first-light-with-master-saao/ . Отчет в Интернет: http://www.pereplet.ru/lipunov/325.html#325 . ... On 2014 December 21, a first light was obtained and on December 23 a first scientific telegram was sent in the Gamma-ray Coordinates Network (NASA). ... All seminars: . ...

Еще в разделе: (Показать все результаты (>32) - master.sai.msu.ru/ )

... MSU Chamber Orchestra . Concerts of . ... 1999/2000 season: . MOSCOW . ... German Music of XVII c. Johann ROSENMULLER (1620 - 1684) . ... Leontyevsky pereulok, 6 (metro station "Arbatskaya" or "Pushkinskaya") . ... MSU Chamber orchestra . ... Ulitsa Fadeeva, 4 (metro station "Mayakovskaya") . ... Big Hall of Moscow State University (the building at Vorobievy Gory) . ... MSU CHAMBER ORCHESTRA . ... The tickets are in the Moscow State Philarmony office . ... Big Hall of Moscow State University . ...

Еще в разделе: (Показать все результаты (>5) - music.genebee.msu.su/ )

• MSU Chamber Orchestra. Concerts. Season 2000/2001.

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>13) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]

.

Еще в разделе: (Показать все результаты (>31) - www.chemport.ru/ )

• Real estate market in december маркетинговые исследования мирового рынка новых

EFFECT OF pH AND VFA ON H YDROLYSIS OF ORGANIC SOLID W ASTE By Adrie Veeken,1 Sergey Kalyuzhnyi,2 Heijo Scharff,3 and Bert Hamelers4 ABSTRACT: The anaerobic hydrolysis rate of organic solid waste was studied at fixed volatile fatty acid (VFA) concentrations ranging from 3 to 30 g COD/ L and fixed pH values between 5 and 7. ... In this way, it was possible to distinguish between the inhibitory effects of pH, total VFA, and undissociated VFA on anaerobic hydrolysis. ... VFA control. ...

Еще в разделе: (Показать все результаты (>107) - www.enzyme.chem.msu.ru/ )

• http://www.enzyme.chem.msu.ru/ekbio/article/hav_met.pdf
• http://www.enzyme.chem.msu.ru/ekbio/article/mulder_2006.pdf
• Senko O.V.

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

БАКАЛАВРИАТ . ... MBA . EXECUTIVE MBA . ... Завершается напряженный учебный год! ... забег на дистанцию 4 км; . ... Дата: 28 мая 2011 год . ... Executive MBA . ... Бакалавриат . ... январь февраль март апрель май июнь июль август сентябрь октябрь ноябрь декабрь 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 . ... Аккредитация программы Бакалавр . Аккредитация финансовых курсов программ Бакалавр и Магистр . ...

Еще в разделе: (Показать все результаты (>501) - www.mgubs.ru/ )

• Высшее образование | Высшая школа бизнеса МГУ им. Ломоносова
• Весенний забег Высшей школы бизнеса МГУ aCROSS the UNIVERSity 2015.
• Осенний кросс Высшей школы бизнеса МГУ aCROSS the UNIVERsity

... Географии мирового хозяйства . Геохимии ландшафтов и географии почв . Гидрологии суши . ... Рекреационной географии и туризма . Социально-экономической географии зарубежных стран . Физической географии и ландшафтоведения . ... Выберите кафедру . ... Ученый совет . ... Кафедры . ... География" . ... Образование . ... Научно-методический совет по экологии Министерства образования и науки РФ . ... Кафедра гидрологии . ... Просмотров: 148 Тема: hmokn в форуме: Кафедра гидрологии . ...

Еще в разделе: (Показать все результаты (>241) - www.geogr.msu.ru/ )

• Instructions for Authors, contributing to “GEOGRAPHY, ENVIRONMENT,
• CONTENT 2 (3) 2010
• fake louis vuitton louis vuitton outlet store cheap sales

... Начало www.99ru.ru Другое 6242 . ... Введите код товара из каталога. автор 1984 . ... 6242 . 1984 . ... Brick 2 x 4 Красный 8 X Brick 2 x 4 Синий 2 X Train Weight 2 x 6 x 2 - bottom openings, center seam on short sides Красный 24 X Technic , Brick 1 x 2 with Hole Красный 24 X Technic , Brick 1 x 2 with Hole Синий 24 X Technic , Brick 1 x 4 with Holes Синий 16 X Technic , Brick 1 x 4 with Holes Красный 4 X Technic , Brick 1 x 6 with Holes Синий 4 X Technic , ...

Еще в разделе: (Показать все результаты (>14) - www.bukivedi.ru/ )

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>62) - scon155.phys.msu.su/ )

... Symmetry in Bubble Dynamics . ... An investigation on novel lines is made into the problem of nonlinear bubble dynamics. ... The complete symmetry groups are found for the Rayleigh equation. ... The possible application of the scaling law dynamics to the problem of stable single bubble sonoluminescence is discussed. Conformal symmetry of Laplace equation provides an approach for finding exact solutions for the pulsation of gas bubble tethered to a rigid wall. ...

Еще в разделе: (Показать все результаты (>411) - acs366.phys.msu.su/ )

• General Information

Еще в разделе: (Показать все результаты (>6712) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006
• Brief report about the conference "University Satellites and Space Science
• Новости

... ACAT'2003 : IX INTERNATIONAL WORKSHOP ON ADVANCED COMPUTING AND ANALYSIS TECHNIQUES IN PHYSICS RESEARCH (ACAT03), 1-5 December, 2003, Tsukuba, Japan. ... Advanced Statistical Methods for Data Analysis Traditionally, researchers from high energy and nuclear physics together with experts in computer science take part in the ACAT series of workshops. ... Thus, researchers from these and other fields are welcome to join us in discussions on modern computing techniques and ways for new developments. ...

Еще в разделе: (Показать все результаты (>60) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/ohl/acat2002.pdf
• http://acat02.sinp.msu.ru/presentations/mueller/folie.ps
• http://acat02.sinp.msu.ru/plenary.html

... People . ... Photogallery: Chirinda, Evenkia, July-August 2007 . ... A house where people live . ... Valentina Khristoforovna Yoldogir . ... Audio recording the Evenki word list: the young people are working (Yulia Kombagir and Ilia Yoldogir, Ilia’s brother Misha listening) . ... Valentina Khristoforovna Yoldogir watching the video recording of her telling an Evenki fairy tale . ... Valentina Khristoforovna Yoldogir is telling an Evenki fairy tale to us and to her grandchildren sitting in the tent ....

Еще в разделе: (Показать все результаты (>12) - lcl.srcc.msu.ru/ )

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>11) - sbmg.geol.msu.ru/ )