... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>85) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help
• GeneBee BLAST 2.2.22+ Services .

... The documents on academic background should be translated into Russian and attested by the Russian Embassy in the country where the documents were issued, or by the Embassy of your country in Russia, or by a notary in Russia. Graduation certificate of the Center for International Education at MSU, or Preparatory Course at a state university in Russia, or Certificate of the Russian Language test and tests in Physics and Mathematics, . ... Russian Language Summer Program . ...

Еще в разделе: (Показать все результаты (>18) - foroff.phys.msu.ru/ )

• Useful Information

General Information . ... Local Information . ... The city represents great cultural value because in the late 19th and early 20th centuries, Kislovodsk as a fashionable spa attracted many musicians, artists, and members of the Russian aristocracy. ... Double room with full pension (breakfast, lunch, dinner) - 2620 rubles per person per night. solnechniy . ... Citizens of most countries need visa to enter the Russian Federation. ... Victor Kornilov, Sternberg Astronomical Institute (chair) . ...

Еще в разделе: (Показать все результаты (>12) - site2010.sai.msu.ru/ )

... Structure and properties of chimeric small heat shock proteins containing yellow fluorescent protein attached to their C-terminal ends. ... Recombinant chimeras of small heat shock proteins (sHsp) HspB1, HspB5, and HspB6 containing enhanced yellow fluorescent protein (EYFP) attached to their C-terminal ends were constructed and purified. Some properties of these chimeras were compared with the corresponding properties of the same chimeras containing EYFP attached to the N-terminal end of sHsp. ...

Еще в разделе: (Показать все результаты (>7) - biochem.bio.msu.ru/ )

Open Conference Systems . Conference Help . ... Conference Content Search . ... Conference Information . ... By Conference . ... Home > ICONO/LAT 2016 > Intl. Conf. on Coherent and Nonlinear Optics/Intl. Conf. on Lasers, Applications, and Technologies . The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... ICONO/LAT 2016 will be held in Minsk, the capital and largest city in Belarus, The oldest mentions of Minsk date back to 1067. ...

Еще в разделе: (Показать все результаты (>20) - hea.phys.msu.su/ )

• ICONO/LAT 2016
• Search

.

Еще в разделе: (Показать все результаты (>21) - www.chemport.ru/ )

• Real estate market monitoring september 2011 3 дрсу база данных землевладельцев

Backlinks to TimeSpecifications in all Webs ( Search System Web only ) . ... NEW - 19 Sep 2010 - 15:29 by ProjectContributor . ... Query Search Query searches help you search the contents of forms attached to your topics, as well as the values of other meta data attached to the topic. Using query .. ... VarSEARCH SEARCH{"text"} search content * Inline search, shows a search result embedded in a topic * Syntax: %SEARCH{"text" .. ... Ideas, requests, problems regarding Foswiki? ...

Еще в разделе: (Показать все результаты (>18184) - wiki.cs.msu.ru/ )

• (backlinks in System Web) TimeSpecifications < System < Foswiki
• (backlinks in all Webs) VarQUERY < System < Foswiki
• (backlinks in System Web) VarQUERY < System < Foswiki

Warning : oci_connect(): ORA-12543: TNS:destination host unreachable in / home / swx / public_html / models / sw_forecast.php on line 3 Warning : oci_parse() expects parameter 1 to be resource, boolean given in / home / swx / public_html / models / sw_forecast.php on line 4 Warning : oci_execute() expects parameter 1 to be resource, null given in / home / swx / public_html / models / ...

Еще в разделе: (Показать все результаты (>10) - swx.sinp.msu.ru/ )

• http://swx.sinp.msu.ru/models/get_charea.php

... please find attached the second announcement about the VII Moscow International Conference on Operations Research (ORM2013) in October, 15-19, 2013 in Moscow, Russia. You are welcome to submit extended abstracts of your talks to 2013ORM@gmail.com. An extended abstract should be presented as a LaTex file in English language according to the attached template, and its volume should be three pages (or little less). Selected extended abstracts will be published in the Conference proceedings. ...

Еще в разделе: (Показать все результаты (>8) - io.cmc.msu.ru/ )

... International Conference Advanced Carbon Nanostructures (ACNS'2015), June 29 - July 3, 2015, St. Petersburg, Russia. ... March 20, 2012, Moscow, Russia. ... IX International Conference Atomic and Molecular Pulsed Lasers, September 14th-18th, 2009, Tomsk, Russia. 21st Colloquium on High Resolution Molecular Spectroscopy, August 31st-September 4th 2009, Castellammare di Stabia, Italy. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>22) - rswater.phys.msu.ru/ )

• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и
• Photo report: Participation in 21st Colloquium on High Resolution Molecular

The Third International Symposium UNIVERSAT- 2009 : UNIVERSITY SATELLITES in SPACE SCIENCES EDUCATION 28 September ­ 1 October, 2009 and The Sixth HANDS-ON SPACE SCHOOL FOR UNIVERSITY STUDENTS AND TUTORS 2 ­ 4 October, 2009 Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University , Moscow , ... UNIVERSAT-2009 is a satellite symposium of the Space 2009) announced by Space Research Institute of Russian (Moscow, Russia). ... Projects of Future University Missions, 3. ...

Еще в разделе: (Показать все результаты (>51) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University
• University Satellites and Space Science Education '2006
• UNIVERSAT-2009: University Satellites in Space Sciences Education, Zvenigorod,

. To be sent no later than July 15 1999 . Surname First names : . Organisation/Institution: . Mailing address: . Email : . Telephone : . Fax (Full International) : . I expect to attend the Conference: . sure probably . I expect to be accompanied by . I expect to present a paper . Title of paper . Topic of the Conference . I expect to present a poster . Title of poster . Topic of the Conference .

Еще в разделе: (Показать все результаты (>115) - www.fadr.msu.ru/ )

• Abstracts
• Untitled
• Paleopedology Comission Web-site

... To save time, I will only provide ephemerides in 2000 coordinates. ... Note: most the orbital elements used to create these ephemerides were obtained from the International Astronomical Union Circulars (IAUCs), Minor Planet Circulars (MPCs) or the ICQ Comet Handbook. ... The following 1-day ephemeris (March 1, 1997 - October 1, 1997) is from Donald Yeomans of JPL and is based on Reference Orbit #55 (March 4, 1997). 2000 coordinates (March - September, 1997) [3/4/97] . ... Epoch: 1997 Feb. 1.0 . ...

Еще в разделе: (Показать все результаты (>13) - www.issp.ac.ru/ )

• International Olympiad of Euro-Asian Astronomical Society
• Gavrilov M.G. "Zviozdnyj Mir", vol.IV
• Founding Statutes

... Men like to include fashionable touches their look. ... Here are some accessories adorned by men. ... Blue Harbor burberry scarfs Store Activity Links: September 28-October 19. Men season even more refined. Astro Boy the little young man, . ... Tide still knitting Classic knit family (Classic Cardy) since its launch setting it able to replace the task. ... Hermes handbags are status symbols true classic shapes and luxurious leather. ...

Еще в разделе: (Показать все результаты (>71) - elana.sinp.msu.ru/ )

• September 26 | С Днем Победы!
• editor | С Днем Победы!

RAPID COMMUNICATIONS PHYSICAL REVIEW E 73, 045302 R 2006 Surface roughness and hydrodynamic boundary conditions Olga I. Vinogradova* and Gleb E. Yakubov Max Planck Institute for Polymer Research, Ackermannweg 10, 55128 Mainz ... Academy of Sciences, 31 Leninsky Prospect, 119991 Moscow, Russia Received 25 September 2005; published 27 April 2006 We report results of investigations of a high-speed drainage of thin aqueous films squeezed between randomly nanorough surfaces ... Phys. Rev. Lett. ...

Еще в разделе: (Показать все результаты (>27) - nanofluidics.phys.msu.ru/ )

• Teaching

Design of Micrometeoroid/Orbital Debris Impact Shield and Development of Failure Risk Assessment System for Orbital Spacecraft N.G. Chechenin Skobeltsyn Institute of Nuclear Physics Lomonosov Moscow State University Space Debris Growth http://www.nasa.gov/pdf/582393main_OCT-Orbital_ Debris _TAGGED.pdf January 19, 2015 China-Russia Joint Space Science Project Proposals Workshop 2 Space ... Crater formation January 19, 2015 Craters on metal surface from meteoroid particle. ...

Еще в разделе: (Показать все результаты (>68) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Articles_GSIB/nimb237_235_reviewGCIB_SConductors.pdf

... Anisotropy effects investigations by resistivity method. ... I.N.Modin. ... Pervago E.V., Bobachev A.A., Modin I.N., Shevnin V.A. Report, presented at Annual SAGEEP conference, April 1995, Orlando, Florida, USA. 1 p. RESISTIVITY PROSPECTING IN URBAN REGIONS . ... Bobachev A.A., Modin I.N., Pervago E.V.Proceedings of 5th EEGS-ES Meeting in Budapest, Hungary, September 1999. ... Bobachev A.A. Modin I.N., Pervago E.V., Shevnin V.A.Proceedings of 5th EEGS-ES Meeting in Budapest, Hungary, September 1999....

Еще в разделе: (Показать все результаты (>26) - geophys.geol.msu.ru/ )

... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...

Еще в разделе: (Показать все результаты (>4) - dubrovinlab.msu.ru/ )

... Published: 08 September 2014 . Dear second-year students, let me congratulate you on the beginning of the new academic year! ... First class will be on September 5 2014, at 17:05, N8. Sergey Yakovlev is the teacher. " 8-bit microcontrollers ". First class will be on September 9 2014, at 17:05, 3-14 (KNO). Vladimir Bruevich is the teacher. ... Alexander Karabutov and Yuriy Rumyantsev are the teachers. ... Anatoliy Sizov is the teacher. Introduction to Linux ".љ ...

Еще в разделе: (Показать все результаты (>17) - engineering.phys.msu.ru/ )

• Meeting with the representatives of Argentine