О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>31) - erg.biophys.msu.ru/ )

• Quantum chemistry information page ERG Research Group: Лаборатория
• All-atom automatic OPLS-AA topology generator ERG Research Group: Лаборатория

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

NAME dbmmanage - Create and update user authentication files in DBM format SYNOPSIS dbmmanage filename [ command ] [ username [ encpasswd ] ] DESCRIPTION dbmmanage is used to create and update the DBM format files used to store usernames and password for basic authentica- tion of HTTP users. Resources available from the httpd Apache web server can be restricted to just the users listed in the files created by dbmmanage. ... This manual page only lists the command line arguments. ...

Еще в разделе: (Показать все результаты (>73) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules
• Apache Tutorial: .htaccess files
• Apache modules

Nurtdinov RN, Neverov AD, Mironov AA and Gelfand MS. (2006) Conserved and species-specific alternative splicing in mammalian genomes. submitted . Ermakova EO, Nurtdinov RN and Gelfand MS. (2006) Fast rate of evolution in alternatively spliced coding regions of mammalian genes. BMC Genomics. ... BMC Bioinformatics. ... 2004) J Mol Evol. ... Nurtdinov RN, Artamonova II, Mironov AA and Gelfand MS. (2003) Low conservation of alternative splicing patterns in the human and mouse genomes. ...

Еще в разделе: (Показать все результаты (>3) - edas2.bioinf.fbb.msu.ru/ )

Международный учебно-научный лазерный центр МГУ им. М.В. Ломоносова . Главная . ... О МЛЦ МГУ . Наука . ... Публикации . ... 10.10.2015 . ... Главная Публикации . ... Опубликовано: Laser Physics, 13(10), 1-5 . ... Абстракт: The most general approaches to determining the quantitative measure of quantum information are analyzed based on physical content. Dynamic information is proposed as an alternative to coherent information. ... 2008 МЛЦ МГУ . ...

Еще в разделе: (Показать все результаты (>41) - ilc.phys.msu.ru/ )

... The circumnuclear GASEOUS disks are often decoupled from the circumnuclear stellar disks and are even stronger inclined to the outer disk planes; in fact, we have found a considerable `population' of inner polar rings. Inner gas polar rings are found as in spiral galaxies with the massive outer gas disks co-planar to the main symmetry planes (e.g. NGC 2841, Sil'chenko et al. 1997, and NGC 7217, Sil'chenko & Afanasiev 2000) as well in many lenticular galaxies (Fig. ...

Еще в разделе: (Показать все результаты (>49) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/my_an.pdf
• http://sn.sai.msu.ru/~sil/preprints/al75.pdf
• http://sn.sai.msu.ru/~sil/preprints/bul_eng.pdf

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>25) - cryst.geol.msu.ru/ )

... P. Vabishchevich, M. R. Shcherbakov, V. O. Bessonov, T. V. Dolgova, A. A. Fedyanin . ... download . Maxim R. Shcherbakov, Polina P. Vabishchevich, Alexander S. Shorokhov, Katie E. Chong, Duk-Yong Choi, Isabelle Staude, Andrey E. Miroshnichenko, Dragomir N. Neshev, Andrey A. Fedyanin, and Yuri S. Kivshar . ... Frolov, Polina P. Vabishchevich, Maxim R. Shcherbakov, Tatyana V. Dolgova, Andrey A. Fedyanin . ... Frolov, P. P. Vabishchevich, M. R. Shcherbakov, T. V. Dolgova, A. A. Fedyanin . ...

Еще в разделе: (Показать все результаты (>65) - nanolab.phys.msu.ru/ )

• Ultrafast magnetophotonics | Laboratory of Nanophotonics & Metamaterials
• Ultrafast plasmonics and magnetoplasmonics | Laboratory of Nanophotonics &
• Students can now use the homework download system and track their current

. Name . Last modified . Size . Description . about_center/ . 14-Sep-2013 14:31 . - . sections/ . 31-Oct-2007 14:46 . - . Apache/2.2.16 (Debian) Server at educenter.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>9) - educenter.sinp.msu.ru/ )

• Index of /about_center/workplaces
• Index of /about_center
• Index of /sections

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>5) - iconolat13.phys.msu.ru/ )

• Guidelines

... Earlier still lies the remaining frontier, where the first stars, galaxies and massive black holes formed. ... Building on this general framework, and relying on the development of efficient new computational tools, the fragmentation properties of primordial gas inside such minihaloes were investigated with numerical simulations, leading to the result that the first stars, so-called population III, were predominantly very massive4,8 (see Box 1 for the terminology used here). ... Astrophys. ... III. ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf
• http://ocean.phys.msu.ru/science/nosov/EGU2010_initial_condition.pdf
• http://ocean.phys.msu.ru/courses/geo/lectures-addons/02/2006%20Wood%20et%20al.%2C%20Accretion%20of%20the%20Earth%20and%20segregation%20of%20its%20core.pdf

Geometric Structures in Integrable Systems Sergey Adzhiev (with Victor Vedenyapin), Entropy for generalised quantum kinetic and Liouville equations. Abstract: In his 1872 paper L. Boltzmann proved H-theorem for a class of kinetic equations. ... Abstract: P. Clarkson and M. Kruskal (1989) proposed a method for finding reductions of partial differential equations with two independent variables. ... Gennady El, Kinetic equation for a soliton gas ­ a new integrable system? ...

Еще в разделе: (Показать все результаты (>32) - new.math.msu.su/ )

• http://new.math.msu.su/department/hydro/papers/Osiptsov-Asmolov-PoF-2008.pdf
• http://new.math.msu.su/department/composite/konyukh.doc

... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...

Еще в разделе: (Показать все результаты (>27) - analyt.chem.msu.ru/ )

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>21) - rswater.phys.msu.ru/ )

... Departments . ... Head of the department: Moiseev Evgeny, Academician of RAS, Professor, Dr. Sc., Dean of the Faculty CMC MSU Contact information . ... Main topics are: boundary value and spectral problems for PDEs of elliptic and mixed type, spectral analysis, boundary control problems for oscillating processes, linear integral equations, completeness and basis properties of functional systems. ... Functional Analysis by Prof. Moiseev, 64 hours, 5th semester. ... Functional Analysis by Assoc. ...

Еще в разделе: (Показать все результаты (>115) - en.cs.msu.ru/ )

• Department of Functional Analysis and its Applications
• Laboratory of Industrial Mathematics | CMC MSU
• Laboratory of Industrial Mathematics