... Michael Y. Galperin , Eugene V. Koonin National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, Maryland 20894, USA, galperin @ncbi.nlm.nih.gov, koonin@ncbi.nlm.nih.gov Armen Y. Mulkidjanian School of Physics, University of OsnabrЭck, D-49069 OsnabrЭck, Germany; Faculty of Bioengineering and Bioinformatics, and A.N. Belozersky ... Life Evol. ... Deamer, D.W. (2008) Origins of life: how leaky were primitive cells, Nature, 454: 37­38. ...

Еще в разделе: (Показать все результаты (>165) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/117.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/195.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/96.pdf

Institute of Theoretical Geophysics . ... Consortium for Electromagnetic Modeling and Inversion (University of Utah) . SJ Geophysics Ltd . INFOMINE / Geomine - Geological Exploration and Technology (Links collection) . ... Zonge Engineering: Geophysical Modeling . CEMI software developed at the Center for Electromagnetic Modeling and Inversion (University of Utah). ... AGI Res3Dinv - 3D Resistivity Inversion Software . RINVERT - Resistivity Models and Modeling (or Modelling) Software . ...

Еще в разделе: (Показать все результаты (>62) - geophys.geol.msu.ru/ )

• IPI2win - 1D interpretation of VES profile.

... Anti thrombin DNA aptamers were immobilized on silica microspheres, placed inside microwells on the distal tip on an imaging optical fiber, coupled to a modified epifluorescence microscope through its proximal tip. ... It should be mentioned that since thrombin is not a DNA binding protein, the possibility to elicit thrombin­aptamer complexes clearly demonstrates the power of SELEX technology. ... Specificity of aptamer coated beads for F thrombin binding was assessed with bovine serum albumin. ...

Еще в разделе: (Показать все результаты (>4) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf
• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf

... Definitions in the INQUA Paleopedology Commission, Holliday argues that . ... Holliday also claims that adoption of GEOSOL as the term for the basic . pedostratigraphic unit in the 1983 North American stratigraphic code was . ... American Stratigraphic Code (North American Stratigraphic Commission, . ... is the best name for the basic pedostratigraphic unit. ... pedofacies) admitted into the North American Stratigraphic Code-and . ... North American Stratigraphic Commission, 1983, North American . ...

Еще в разделе: (Показать все результаты (>144) - www.fadr.msu.ru/ )

• http://www.paleopedology.msu.ru/discussions/messages/246.html
• Foundation for Agrarian Development Research - Projects
• Total web report on fadr.msu.ru - October 2004

... Published: 30 October 2014 . Science Festival took place in Moscow on October 10-12 2014 . Science Festival include more than 80 different areas. ... Engineering Physics Laboratory demonstrated different robots: balancing robot, LIDAR area scanner, jumping robot Z-Hopper and speech depersonalizer. We also entertain visitors with liquid nitrogen. Everybody could pour it on hands, breathe it and look at the frozen things in nitrogen. ...

Еще в разделе: (Показать все результаты (>17) - engineering.phys.msu.ru/ )

• Science Festival 2013
• Introduction to Linux
• Science Festival 2014

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• ConClus

... OK ======================================= To compile CompHEP input make command ======================================= make # command output : ****************************************************************** * CompHEP -4.4p3 has been successfully built * * * * Please create a user working directory using the command * * make setup WDIR=path_to_your_user_work_dir * * NOTE: Do not use '~' to refer to home ... CompHEP-interfaces-1.0.1 has been installed successfully!! ...

Еще в разделе: (Показать все результаты (>7) - lhe.sinp.msu.ru/ )

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>15) - imk.msu.ru/ )

Programme of the International Congress Globalistics-2015 : Global Governance and Diplomacy in the Unstable World dedicated to the 70th anniversary of the UN and the Year of RUSSIA's Presidency ... 26th OCTOBER 09:3011:00 Registration of the participants of the International Scientific Congress Globalistics-2015 Venue : Intellectual Centre - Fundamental Library of Moscow State University, the 1st floor hall ... P-6 Address: Leninskie Gory, 1, b.51 (Metro "Universitet"). ...

Еще в разделе: (Показать все результаты (>1533) - fgp.msu.ru/ )

• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

... However, the development of this technique depends on the availability of high performance transducers adapted to power generation constraints allowing to focus and or steer the ultrasonic energy within the volume to be treated. ... In the case of generating CW or long burst wave, problems to be solved are mainly thermal ones while generating very high pulsed pressure wave demands to solve electrical breakdown and mechanical problems. ...

Еще в разделе: (Показать все результаты (>175) - acs366.phys.msu.su/ )

• Abstract

... Langmuir-Blodgett (LB) technique becomes now an effective tool producing thin molecular films of desired composition and structure. Its development gave rise to numerous experimental investigations of LB films as nonlinear optical wave guides devices. ... It seems to show that effects of LB films structure on their nonlinear optical parameters are mainly connected with specifics of their local field distribution. ...

Еще в разделе: (Показать все результаты (>23) - scon155.phys.msu.su/ )

• Photoelectric phenomena and metastable states in amorphous semiconductors

Intel® Fortran Compiler Options Quick Reference Guide for Linux* Systems Legal Information Copyright © 2003 Intel Corporation Document Number: 253258-001 i Intel® Fortran Compiler Options Quick Reference Disclaimer and Legal Information Information in this document is provided in connection with Intel products. No license, express or implied, by estoppel or otherwise, to any intellectual property rights is granted by this document. EXCEPT AS PROVIDED IN INTEL'S TERMS AND CONDITIONS OF SALE FOR SUCH

Еще в разделе: (Показать все результаты (>10) - www.arcetri.astro.it/ )

. Links . arXiv.org (Lanl gov) . Large amount of articles . http://arXiv.org . Scientific Electronic Library . http://www.elibrary.ru . Elsevier Science; Kluwer Academic Publishers; Springer Berlin Heidelberg . and others... Laboratory of Theoretical Nonlinear Dynamics in Institute of Radio-Engineering and Electronics of RAS, Saratov Branch IRE RAS . http://www.sgtnd.tserv.ru . Head of the group Doctor of Sciences, Professor Sergey P. Kuznetsov . Painter Andrey Isaev . http://www.IsaevArt.ru .

Еще в разделе: (Показать все результаты (>43) - chaos.phys.msu.ru/ )

. Sea1 . Lighthouse . Library . Distorting mirrors . Distorting mirrors 2 . Bar1 . Bar2 .

Еще в разделе: (Показать все результаты (>36) - shg.phys.msu.ru/ )

• List of selected publications

, (exch. chem . msu . ru ), -, . , , . , , . http://www.chem.msu.ru/rus/library/licenced.html , http://www.msu.ru/resources/electron.html 1/1

Еще в разделе: (Показать все результаты (>3) - sci.chem.msu.ru/ )

THE FIRST JAPAN-RUSSIA MEDICAL FORUM PROGRAM Date: December 10, 2012 Venue : Intellectual Center - Fundamental Library of Lomonosov Moscow State University Bld.27, Lomonosovskiy prospect, Moscow , 119991, Russia Organizers: Lomonosov Moscow State University Tohoku University Supported by Embassy of ...

Еще в разделе: (Показать все результаты (>7) - fbm.msu.ru/ )

... COLAMO [1] . Fire!Constructor [2], . ... Fire!Constructor ( Include COLAMO). ... 4 - Fire!Constructor COLAMO - ARGUS. ... ARGUS : Define N = 5; Define K = 6; Define M = 1; DMC[0.A] # Metka : Read A step M repeat K; Add A, K; Loop N Goto Metka; DMC[0.C] # Metka1 : Read C step M repeat K; Add C, K; Loop N Goto Metka1; DMC[0.D] # Metka2 : Read D step M repeat K; Add D, K; Loop N Goto Metka2; DMC[0.B] # Metka3 : Write B step M repeat K; Add B, K; Loop N Goto Metka3; Read ­ , (.. ...

100. NEW MSU Graduates Club notice board