... COMPUTATIONAL . ... Scientific description and computerization of archives . Researchers of the Rare Books and Manuscripts Department of the Scientific Library of Moscow State University, the Orthodox Svyato - Tikhonovsky University and the Laboratory for Computational Lexicography are working on the scientific description of I. A. Ilyin’s personal archives. ... The conception of scientific description and computerization of archives was developed within the framework of this project. ...

Еще в разделе: (Показать все результаты (>5) - lcl.srcc.msu.ru/ )

... Дисциплины . ... On-line консультант . ... Главная Дисциплины Основы IT - менеджмента . Лектор и автор курса Козлов Д.Д. В курсе рассматриваются вопросы выстраивания экономически эффективной ИТ-инфраструктуры предприятия на основе сервисно-ориентированной модели ITSM. В рамках курса изучается библиотека IT Infrastructure Library и рассматриваются процессы управления информационно-коммуникационной инфраструктурой, предоставления и поддержки услуг. ... Copyright ВМиК МГУ , 2008 . ...

Еще в разделе: (Показать все результаты (>4) - erp.cmc.msu.ru/ )

... Host City . ... Aug 31, 10.00 Excursion to Dmitrov . Excursion to Dmitrov Visit the ancient Russian town of Dmitrov and shake hands with Yuri Dolgoruki, a medieval Russian prince, who incidentally happens to be also the founder of the city of Moscow. Dmitrov known as the Moscow's Nohern pearl is just 65 kilometers north of Moscow on the suburban road. ... Dmitrov finally entered the Moscow county in the 16th century, after a lengthy internal struggle among its princes. ...

Еще в разделе: (Показать все результаты (>4) - www.elch.chem.msu.ru/ )

Magnetism Department MSU . ... Magnetism department . ... Students . Phd students . ... For 2 grad students . ... Grad. students . ...

Еще в разделе: (Показать все результаты (>17) - magn.phys.msu.ru/ )

• Information for PhD students
• Some materials
• Collaboration

... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Conference Venue . Conference Opening ceremony will take place on Tuesday, June 17 at 13:00 in the MSU Library Building . ... On other conference days registration will be possible in the room 706 of the 2-nd Educational Building. ...

Еще в разделе: (Показать все результаты (>9) - pont2008.cmc.msu.ru/ )

• Timetable of plenary lectures Международная конференция Дифференциальные

... Solver is implemented in CUDA Numerical Simulation of the Ice Moving in Strati ed Fluid PhD Degree Obtained in 2013 By using GPU we are able to perform computations with higher resolution which gives us an opportunity to study the interaction between sea ice and ocean in greater details Evgeny Mortikov, MSU Research Computing Center , researcher, evgeny.mortikov@gmail.com The project aims at determining the relevance of ocean strati cation for ...

Еще в разделе: (Показать все результаты (>31) - hpc.msu.ru/ )

• Trainings on Application Development and Optimization | Moscow University
• TOWARDS PETAFLOPS | Moscow University Supercomputing Center

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>36) - curl.sai.msu.ru/ )

• atmos 3.0 page
• Index of /pub/
• Index of /pub/mirror/

... Published: 30 October 2014 . Science Festival took place in Moscow on October 10-12 2014 . Science Festival include more than 80 different areas. ... Engineering Physics Laboratory demonstrated different robots: balancing robot, LIDAR area scanner, jumping robot Z-Hopper and speech depersonalizer. We also entertain visitors with liquid nitrogen. Everybody could pour it on hands, breathe it and look at the frozen things in nitrogen. ...

Еще в разделе: (Показать все результаты (>21) - engineering.phys.msu.ru/ )

• Science Festival 2013
• Introduction to Linux
• Science Festival 2014

... Brown x26; Mussett The Inaccessible Earth 01 Introduction.pdf . ... Brown x26; Mussett The Inaccessible Earth 02 Chapter.pdf . ...

Еще в разделе: (Показать все результаты (>52) - ocean.phys.msu.ru/ )

• Index of /courses/geo/lectures-addons/
• Index of /courses/geo/lectures-addons-11/
• Index of /courses/geo/lectures-addons/02/

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Align tool for DNA-protein complexes

Lomonosov Moscow State University . ... Academic Programs . Academic Board . International Cooperation . ... Academic Departments Programs . ... Bulletin of Moscow University . ... Contact Us . Phone Email Directory . ... Phone: (495) 734 03 22 . Fax: (495) 932 88 67 . ... Phone: (495) 932 99 15 . ... Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University: . ... 2000 - 2016 Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>96) - ffl.msu.ru/ )

• Научная жизнь
• About Us

Pipe Line Filtering Dmitry V. Yurin Moscow State University, Faculty of Computational Mathematics and Cybernetics, Lab. of Mathematical Methods of Image Processing. yurin_d@inbox.ru Abstract A unified template C++ library is proposed for image filtering by local environment. ... It makes easy to combine filters and transfer output of filters to input of others. ... Otherwise, each filter one time should process input and output lines with the same relative numbers in the images. ...

Еще в разделе: (Показать все результаты (>81) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2008.cyprus.yurin_kravtsov.scripting.en.pdf

Programme of the International Congress Globalistics-2015 : Global Governance and Diplomacy in the Unstable World dedicated to the 70th anniversary of the UN and the Year of RUSSIA's Presidency ... 26th OCTOBER 09:3011:00 Registration of the participants of the International Scientific Congress Globalistics-2015 Venue : Intellectual Centre - Fundamental Library of Moscow State University, the 1st floor hall ... P-6 Address: Leninskie Gory, 1, b.51 (Metro "Universitet"). ...

Еще в разделе: (Показать все результаты (>1558) - fgp.msu.ru/ )

• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>13) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/stev/m_download.php

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>2) - ocl.sai.msu.ru/ )

. If you see this page, the nginx web server is successfully installed and working. Further configuration is required. For online documentation and support please refer to nginx.org . Commercial support is available at nginx.com . Thank you for using nginx.

97. Links

98. http://www.fbm.msu.ru/upload/news/2012/12-05/progr.doc

99. Вычислительные библиотеки, использующие ГПУ

100. http://fpga.parallel.ru/papers/gudkov.pdf