О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>22) - erg.biophys.msu.ru/ )

... 3 ­ Sternberg State Astronomical Institute, Moscow, :jeanna@sai.msu.ru The graphic method of the analysis of an arrangement of linear structural elements on geographical and geological maps of continents (A.V.Dolitsky, [1]) has allowed to find out global stress fields of the past and among them one which directions (the main normal and maximal tangents) describe more than 80 % of all linear elements of a relief. ... The found poles share program way on density of an arrangement on 3-4 groups. ...

Еще в разделе: (Показать все результаты (>79) - selena.sai.msu.ru/ )

• Бережной А.А.
• Родионова Жанна Федоровна
• Yurii Naumovich Lipsky

... Grants management . ... FADR has considerable experience in the management of International and Russian Grants. FADR projects are funded by US AID, Eurasia Foundation, Canadian International Development Agency (CIDA), Russian Foundation for Basic Research, Moscow University, etc. ... In 1996-1997 and 1998-1999 FADR work was funded by EURASIA FOUNDATION within grants M96-0823 "Internet Resources for Agrarian Development and Non-Governmental Organizations" and M98-2035 "Internet-Agro" . ...

Еще в разделе: (Показать все результаты (>213) - www.fadr.msu.ru/ )

• Abstracts
• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

RUSSIAN version . ... Sergei V. OGURTSOV . ... In 2002-2009 worked as a research scientist in the Department of Vertebrate Zoology of the Faculty of Biology MSU. Ph.D thesis entitled 'Learning the native pond odour as one of the mechanisms of chemosensory orientation of anuran amphibians' at Faculty of Biology MSU in 2004. ... Ogurtsov S.V., 2004. Olfactory orientation in anuran amphibians // Russian Journal of Herpetology, V. 11, ?1, p. 35-40. [download pdf-file] . Ogurtsov S.V., 2005. ...

Еще в разделе: (Показать все результаты (>48) - vertebrata.bio.msu.ru/ )

... Scientific conference . ... International recognition of this outstanding woman and scientist serves as a wonderful example for the young people who have chosen chemistry as the basis for the carrier, and makes it possible to commemorate the important contribution of women in the development of chemistry as a science.  ... Especially in Russia women received possibility of professional realization in chemical science and education through  different ways starting from 1870’s on. ...

Еще в разделе: (Показать все результаты (>144) - www.chem.msu.ru/ )

... Problems and tasks of the research programme . ... Research programme and research problems . ... Glossary of the laboratory-chair . ... Forms of co-operation and communication methods< . ... On the Institute . ... The International Society for the Study of Time . ... Laboratory-chair of modelling the natural references of time . ... Co-operation with the Laboratory-chair of modelling the natural references of time can be carried out in the following mutually complementary forms. ...

Еще в разделе: (Показать все результаты (>360) - chronos.msu.ru/ )

• Computers without Clocks
• Блок Р. (Block R.)

... M.V.Lomonosov Moscow State University . ... In the year 2005, the world leader in the area of information technologies - SAMSUNG Electronics - announces the launching of two educational programs: . ... Genius Scholarship Program at the Seoul National University (GSP-SNU Program) (Samsung Engineering Program) for the Master of Sciences (M.Sc.) ... Genius Scholarship Program at the Sungkyunkwan University (GSP-SKK Program) (Samsung MBA Program) for the Master of Business Administration (MBA) Degree . ...

Еще в разделе: (Показать все результаты (>139) - phys.msu.ru/ )

• Title

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>69) - www.kosmofizika.ru/ )

... Новости . О МЛЦ МГУ . ... Заявки до 25 октября 2015г. Семинар МЛЦ и кафедры . 23.03.2016 . ... Главная Новости Семинар МЛЦ и кафедры . ... квантовому перепутыванию (quantum entanglement), нарушению соотношений Белла, лазерному охлаждению . ... From Einstein s intuition to quantum bits: a new quantum age? ... Based on that concept, a new field of research has emerged, quantum information, where one uses quantum bits, the so-called 'qubits'. ... 2016 Семинар кафедры ОФиВП и МЛЦ . ...

Еще в разделе: (Показать все результаты (>61) - ilc.phys.msu.ru/ )

• Continuing Education and Retraining Program

Кафедра Общей Физики и Волновых Процессов . ... Новости . ... 18.03.2016 . ... Главная Новости Семинар МЛЦ и кафедры . ... квантовому перепутыванию (quantum entanglement), нарушению соотношений Белла, лазерному охлаждению . ... From Einstein s intuition to quantum bits: a new quantum age? ... Based on that concept, a new field of research has emerged, quantum information, where one uses quantum bits, the so-called 'qubits'. ... 2016 Семинар кафедры ОФиВП и МЛЦ . ... Категория: Семинар МЛЦ и кафедры . ...

Еще в разделе: (Показать все результаты (>88) - ofvp.phys.msu.ru/ )

• Laboratory of Quantum Information

... Болезни органов пищеварительной системы . ... б) с распространенным (многоуровневым поражением) проводящей системы сердца. ... Ferrer M. The rick sinus syndrome. ... Rick sinus syndrome in children with a "healthy heart". ... Buracs M., Herzkowits S., Shapiro J., Roquin N. Familial combined sinus node and atrioventricular conduction dysfunction. ... Noseda J., Reiner M., Rothlin H. Familiare bradycarde Rhyth-musstorengen: eine familie mit kranker sinus und atrioven-tricularem block. ...

Еще в разделе: (Показать все результаты (>243) - www.nature.web.ru/ )

... Публикации . ... С.В. Балахонов, Д.С. Лучинкин, М.В. Ефремова, Б.Р. Чурагулов, Ю.Д. Третьяков . ... Hydrothermal synthesis of a novel phase of vanadia-based nanowhiskers" . ... Ю.В. Коленько, А.А. Бурухин, Б.Р. Чурагулов, Н.Н. Олейников . ... Мескин П.Е., Баранчиков А.Е., Иванов В.К., Кистерев Э.В., Бурухин А.А., Чурагулов Б.Р., Олейников Н.Н., Комарнени Ш., Третьяков Ю.Д. "Синтез наноразмерных порошков Co3O4 в гидротермальных условиях с одновременным ультразвуковым воздействием" . ...

Еще в разделе: (Показать все результаты (>30) - www.inorg.chem.msu.ru/ )

• Group of Hydrothermal Synthesis :: Articles
• Group of Hydrothermal Synthesis :: RESS Apparatus
• Группа гидротермального синтеза :: Установка RESS

... The Geostatistical Software Tool is the leading block modeling software in Russia . ... The source data, block models, solids and surfaces are importable/exportable. Block models may hold any quantity of properties. ... Variogram model, trend model, data transform model, declusterisation model, parameters of the search ellipsoid, lriging type, kriging strategy – are considered not as separate things, but as parts of the complete variability model , that is managed from one point. ...

Еще в разделе: (Показать все результаты (>300) - geo.web.ru/ )

• New Data Sets
• Seismic Tomography
• Trusov Sergey's homepage The influence of boundary layer effects on the melt

International Symposium "Erosion and sediment yields in the changing environment" OCT. 11-15 2012 CHENGDU, CHINA International Symposium of IAHS-ICCE in 2012 CHENGDU, CHINA OCT. 11-152012 SYMPOSIUM THEME "Erosion and sediment yields in the changing environment" International Symposium "Erosion and sediment yields in the changing environment" OCT. 11-15 2012 CHENGDU, CHINA 1. ... Electronic files of International Symposium "Erosion and sediment yields in the changing environment" OCT. ...

Еще в разделе: (Показать все результаты (>49) - eng.geogr.msu.ru/ )

• Recreational Geography and Tourism
• Department of Oceanology

... ADSP2181 Data Sheet. ... ********************* ********* * * This sample program is organized into the following sections: * * Assemble time constants * Interrupt vector table * ADSP 2181 intialization * ADSP 1847 Codec intialization * Interrupt service routines ********************************************************* ********* .module/RAM/ABS=0 loopback; {************* ... transmit i? 68 |||! |||! |||+============= control bit ||+-------------|+--------------control bit +---------------- ! ...

Еще в разделе: (Показать все результаты (>3) - lib.sinp.msu.ru/ )

... Do those millions of sites and services provide useful information, or are they just "information pollution"? ... Abstract This is a review of electrochemical information and services available on the internet, and some evaluation of their usefulness for professionals, students, and the general public. ... Two examples are the "Internetchemistry" site [26] and the "Electrochemical Science and Technology Information Resource (ESTIR)", which lists over 1,000 links to electrochemistry-related sites [7]...

Еще в разделе: (Показать все результаты (>66) - electr003.chem.msu.ru/ )

• Boris B. Damaskin
• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage

Education for Sustainable Development: Russian-Swedish Project RUSSIAN SUSTAINABILITY NewsLETTER Special Issue. ... Visit of V. Putin in Sweden Russian - Swedish trade and economic relations Meeting of the Russian - Swedish Committee for Cooperation in Environmental Protection Prospects of the Russian -American cross-border reserve Beringia Environmental management in Russia : Rostekhnadzor Who is who in Russia : Rostekhnadzor Appointment in the National Park Russian ...

Еще в разделе: (Показать все результаты (>166) - www.geogr.msu.ru/ )

• http://www.geogr.msu.ru/science/projects/our/ross_swed/NewsLETTER/3_11.pdf
• http://www.geogr.msu.ru/science/projects/our/ross_swed/NewsLETTER/5_11.pdf
• http://www.geogr.msu.ru/science/projects/our/ross_swed/NewsLETTER/10_11.pdf

... Data . ... Coronas-Photon . ... Solar energetic particles . ... Nucleon . ... Coronas-Photon (Russian: Коронас-Фотон) or Complex Orbital Observations Near-Earth of Activity of the Sun, is a Russian solar research satellite. ... The goal is to investigate the processes of free energy accumulation in the sun's atmosphere, accelerated particle phenomena and solar flares, and the correlation between solar activity and magnetic storms on Earth. ... protons ( 4 - 80 MeV ) . ... particle energies, MeV . ...

Еще в разделе: (Показать все результаты (>21) - smdc.sinp.msu.ru/ )

... List of solitary restriction endonucleases in complete prokaryotic genomes . List of groups of orthologous R-M systems. List of all analyzed genomes. Contains those orthologous groups that include at least one separated R-M system . R-M orthologous group ID . REs alignments . MTases alignment . Group 1 . ...

Еще в разделе: (Показать все результаты (>6951) - mouse.belozersky.msu.ru/ )

• Blocks finder
• wLake algorithm description
• NPG-explorer