Концептуальная неопределенность в расчетах растворимости в системах грунтовых вод: урок вычислений. ... С целью оценки выхода радионуклидов в грунтовые воды рассмотрено 4 компьютерных модели для расчета растворимости минералов, содержащих соединения актиноидов. Рассмотрены случаи расчета растворимости комплекса минералов, растворимости одного минерала, моделирование растворимости из поверхности пород, содержащих исследуемые соединения, и стохастическая модель растворимости. ...

Еще в разделе: (Показать все результаты (>5) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=0&ref_ind=0207100085

The %CALC{"formula"}% macro is handled by the SpreadSheetPlugin . There are around 90 formulae, such as $ABS() , $EXACT() , $EXISTS() , $GET()/$SET() , $IF() , $LOG() , $LOWER() , $PERCENTILE() , $TIME() , $VALUE() . ... CALC{"$SUM($ABOVE())"}% returns the sum of all cells above the current cell . CALC{"$EXISTS(Web.SomeTopic)"}% returns 1 if the topic exists . CALC{"$UPPER(Collaboration)"}% returns COLLABORATION . ... This topic: System > Plugins > SpreadSheetPlugin > VarCALC . ...

Еще в разделе: (Показать все результаты (>2283) - wiki.cmc.msu.ru/ )

• VarPLUGINDESCRIPTIONS < System < Foswiki
• InstalledPlugins < System < Foswiki

... Energy distributions of the cluster ion beams show that both size and energy of cluster ion decrease by numerous collisions with residual gas. ... In this paper, in order to investigate the influence of the collisions with residual gas on cluster beams, the dependence of the cluster ion energy on chamber pressure was studied. ... Chamber pressure dependence of peak energy and collision frequency between cluster ion and residual gas. ... Model of energy loss in a collision with residual gas. ...

Еще в разделе: (Показать все результаты (>103) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/PhysRevA56_1997_2848NMKab.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb206_842_Yamada_GCIB_modellingSmoothing.pdf
• http://danp.sinp.msu.ru/LAS/Teplova05.pdf

JOURNAL OF APPLIED PHYSICS VOLUME 86, NUMBER 6 15 SEPTEMBER 1999 The rate of radiative recombination in the nitride semiconductors and alloys Alexey Dmitrieva) and Alexander Oruzheinikov Department of Low Temperature Physics, Faculty of Physics, M. V. Lomonosov Moscow State University, Moscow, 119899, Russia Received 7 January 1999; accepted for publication 27 May 1999 The radiative recombination rates of free carriers and lifetimes of ... Phys., Vol. ... We will see in the Sec. ...

Еще в разделе: (Показать все результаты (>18) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/rec-GaN.ps.gz
• http://lizard.phys.msu.su/home/science/science.html
• http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-11-JMathSci-Diffuser.pdf

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... New approaches to the synthesis of hybrid materials InP - organic stabilizer . ... To replace the membranes using standard samples CT InP, myristic acid, stabilized, and samples heterostructures InP / ZnSe with two monolayers Accrued zinc selenide and also stabilized myristic acid. ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>76) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials

Japan Student Services Organization (JASSO) Student Exchange Support Program Scholarship for Short-term Study in Japan [as of January 2016] This scholarship is available for qualified international students who are accepted by Japanese universities under student exchange agreements on a short-term basis. ... 7) Students who have a minimum GPA of 2.30 / 3.00 as calculated using JASSO's GPA calculation method shown below, based on a transcript from the previous academic year. ...

Еще в разделе: (Показать все результаты (>146) - phys.msu.ru/ )

• http://phys.msu.su/rus/international/intl-collaboration-agrmnts/docs/Application%20Form%20for%20the%20JASSO%20Scholarship%202016.doc
• Сотрудники физического факультета МГУ

... Oxidative stress induced in rat brain by a combination of 3-nitropropionic acid and global ischemia. ... Combination of global ischemia induced by 3-vessel occlusion of major arteries supplys rat brain and subsequent 5-day reperfusion with intraperitoneal injection of 3-nitropropionic acid induces vigorous oxidative stress in brain tissues accompanied by evident neurological symptoms in Wistar rats. ...

Еще в разделе: (Показать все результаты (>41) - biochem.bio.msu.ru/ )

• Comparison of soluble and placental transferrin receptors as standards for the

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

. [ Войти ] . Главная -> Фильмы -> The Combination . Пользователи . Демо . Деньги . Фильмы . Форум . The Combination . Австралия 2009 . отметить . Драма .

Еще в разделе: (Показать все результаты (>45) - kinfo.ru/ )

• Combination Platter - Фильмы - Kinfo.ru
• Wild Combination: A Portrait.. - Фильмы - Kinfo.ru
• Strange Frequency 2 - Фильмы - Kinfo.ru

Chlorophyll Fluorescence in vivo : A Theory (Part II). ... The model of carbon assimilation V c ( m M C m -3 s -1 ) by phytoplankton is based on light dependence of photosynthesis , which can be described by a coefficient of underwater radiation absorption by photosynthetic pigments of photosystem II in suspension of microalga a PSP (m -1 ) averaged over the spectral range of underwater radiation, where ... According this assumption the photosynthesis rate is equal to: . ...

Еще в разделе: (Показать все результаты (>9) - www.biophys.msu.ru/ )

• Table 1
• Как отмечалось выше, обилие (по Fo) и фотосинтетическая активность
• Сектор информатики и биофизики сложных систем