MSU . Science Park . ... 2-4 June 2014, Moscow hosted the Third International Summit of technology parks and business incubators "Technoparks as new drivers of national economic development." ... To do this for three days at the III Summit held an educational seminar "Managing effective business incubators and technology parks" with American colleagues - Heads of existing industrial parks and technology transfer centers. ... JSC MSU Science Park. ...

Еще в разделе: (Показать все результаты (>16) - www.sciencepark.ru/ )

• MSU Science Park - Publicity
• MSU Science Park - Projects & Partners

... Standard MP4 benchmark . ... Press to visit Firefly version 8.0.0 beta Intel AVX-enabled Core i7 2600K benchmarks page . ... Press to visit PC GAMESS/Firefly version 7.1.F Core i7 940 benchmarks page (Windows 64-bit, HTT and Turbo Boost Technology enabled) . Press to visit PC GAMESS/Firefly version 7.1.E Core i7 benchmarks page (Linux 64-bit, HTT and Turbo Boost Technology disabled) . Press to visit PC GAMESS/Firefly version 7.1.E Core 2 Quadro Q9550 (Yorkfield) benchmarks page . ...

Еще в разделе: (Показать все результаты (>97) - classic.chem.msu.su/ )

• Preliminary PC GAMESS benchmarks on Quad-core Xeon (Clovertown)-based system
• PC GAMESS benchmarks on Quad-core Core 2 Quadro (Kentsfield)-based system
• PC GAMESS v. 7.1 MP2 gradient code benchmarks on Woodcrest-based Windows system

... О проекте . ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... The layout of beam-lines and experimental stations intended for the applications of the X-ray laser-electron generator to the investigation of the elemental composition, material structure and biological objects is discussed. ...

Еще в разделе: (Показать все результаты (>8) - miles.sinp.msu.ru/ )

"­" .. .. , . (Malsagovakh@gmail.com ) .. , , , .. , , Man, society, social development, N.I. Kareev, the historical role of the persone, the individual " ­" .. " " . .. - . The relevance of the based on the growing driving force of social of N.I. Kareev allows social phenomenon. "man­society" ' concept in N.I. Kareev's sociology is individualization and the "creative class" ' s bitth as the development in modern Russia. The conceptual approach to specify the historical and theoretical foundations of this

Еще в разделе: (Показать все результаты (>67) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/2/06.pdf

... Study of the Russian " Silver Age " neology . ... Dictionaries of neologisms constitute an important part of lexicography. ... The peculiarity of our project is the full scope of text (at least published) considered and uniformity of description: dictionary entries of all the authors’ neologisms have the same format (suggested for Khlebnikov’s neology). ... Khlebnikov's neology (N. N. Pertsova). In 1995 "The Dictionary of Khlebnikov's Neologisms" was published. ...

Еще в разделе: (Показать все результаты (>64) - lcl.srcc.msu.ru/ )

Heavy-ion collisions in modified AdS spaces Pozdeeva E.O based on work I.Ya. ... Gubser, Klebanov, Polyakov, 9802109 Witten, 9802150 The gravitational shock wave in AdS 5 space is dual to ultrarelativistic heavy-ion in 4D space-time. ... DISCREPANCY The simple holographic model gives dN c h / d s 2/ 3 The mininal black hole entropy can be estimated by trapped surface area S S trapped =A trapped / 4G N The trapped surface is surface whose null normals all propagate inward. ...

Еще в разделе: (Показать все результаты (>184) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/QFTHEP-2010-PopovAV-1.pdf
• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>106) - scon155.phys.msu.su/ )

• Non-monotone kinetics of persistent photoconductivity in compensated a-Si:H
• New methods of measuring photoelectric parameters of silicon
• Theory of electronic properties of disordered semiconductors and systems with

. Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . Тема обращения: . Описание проблемы: . Введите почтовый адрес: . Войти в систему . Регистрация . Главная . Поиск . Статистика . О проекте . Помощь . Издательство: BioMed Central . Местоположение издательства: United Kingdom . ї 2011-2015 НИИ механики МГУ . Лаборатория 404. Все права защищены. обратная связь . Создать обращение

Еще в разделе: (Показать все результаты (>4786) - istina.msu.ru/ )

• Journal of Location Based Services - журнал | ИСТИНА - Интеллектуальная Система
• Mechanics Based Design of Structures and Machines - журнал | ИСТИНА -
• Herr T. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

Russian Journal of Coordination Chemistry, Vol. ... The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on the Gillespie-Kepert Model . ... Abstract - The set of parameters for calculating the geometry of coordination compounds is suggested on the basis of the molecular mechanic approach complemented by the Gillespie-Kepert model. ...

Еще в разделе: (Показать все результаты (>57) - analyt.chem.msu.ru/ )

• Laboratory of Electrochemical Methods

About BAFIZ . BAFIZ at SINP MSU . ... The main aims of the Project at SINP of MSU . ... Development of the Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE) at SINP of MSU . Development of the tools for Space Physics data utilization and processing . ... The communication infrastructure base of the Project at SINP of MSU is based on Radio-MSU Network . The computational base of the Project at SINP of MSU is Computing Center ALPHA . ...

Еще в разделе: (Показать все результаты (>31) - dbserv.sinp.msu.ru/ )

• Catalogue of Space Storms

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>27) - mouse.genebee.msu.ru/ )

... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>143) - bioinf.fbb.msu.ru/ )

• SDPlight
• SDPsite
• Prot-DNA-Korr: main page

Visual Images of Patriarch Nikon: An Electronic Gallery" consists of nearly fifty artistic depictions of patriarch Nikon and their full bibliographic citations. 2 The gallery evolved out of my dissertation "Patriarch Nikon's Image in Russian History and Culture" (Western Michigan University, 2004) and embodies my main argument that Nikon's resonance in Russian history remains largely unrecognized because traditional histories ? ... Nikon was officially rehabilitated shortly thereafter in 1682. ...

Еще в разделе: (Показать все результаты (>37647) - hist.msu.ru/ )

• Scientific-based Industrial Management in Russia at the beginning of the 20th
• "Novaya i noveishaia istoria" Journal
• Department of Russian History of the 20th Century

THE STRUCTURE AND PROPERTIES OF MONOMOLECULAR FILMS BASED ON N-OCTADECYL-3,4,:9,10-PERYLENE-BIS(DICARBOXYDIIMIDE) . ... Atomic force microscopy, ellipsometry, and piezoquartz microweighing techniques were used to study the characteristic of N-octadecyl-3,4:9,10-perylene-bis(dicarboxydiimide) monomolecular layers depending on the conditions of isolation and the nature of substrate. ...

Еще в разделе: (Показать все результаты (>122) - www.spm.genebee.msu.ru/ )

• INTERPRETATION OF SPM IMAGES OF LANGMUIR-BLODGETT FILMS BASED ON LONG-CHAIN
• Evgeny Menshikov
• FemtoScan Online program

. Frick P., Stepanov R., Sokoloff D.Wavelet based Faraday Rotation Measure Synthesis, DYNCON-10, 9-th Brazilian Conference on Dynamics,Control and Applications, Serra Negra -- San-Paulo, Brazil, June 7-11, 2010. Book of abstract. P.65 . Ключевые слова:

Еще в разделе: (Показать все результаты (>185) - srcc.msu.ru/ )

• Frick P., Stepanov R., Sokoloff D., Beck R. Wavelet based Faraday Rotation
• Laboratory of Informatics
• University Information System RUSSIA

... The RELEC experiment was specially developed for study of relativistic electrons in near-Earth space together with TLEs in order to test possible connection between these two phenomena. ... Data from RELEC mission will be processed for testing TLE models, studying of TGF light curves and spectra, testing possible connection between electron precipitations and low-frequency electromagnetic waves. ... Energy range: 0.1 - 15 MeV (for electrons) . ...

Еще в разделе: (Показать все результаты (>8) - vernov-relec.sinp.msu.ru/ )

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>21) - www.issp.ac.ru/ )

• Chernogolovka

Martes martes . Specific functional forms of behavior in pine marten Martes martes , based on snow tracking data . ... The paper describes the main functional forms of pine martenв?T Martes martes behavior which include leaving refuge, foraging, change of feeding area, patrolling their territory, locomotion to resting site, rest, and running for safety. ... The hierarchy of reactions in mammals is illustrated for the pine marten. ... Human impact changes the structure of behavior in pine martens. ...

Еще в разделе: (Показать все результаты (>1610) - zmmu.msu.ru/ )

• Russian Journal of Theriology
• A preliminary study on molecular phylogeny of giant flying squirrels, genus
• Molecular phylogenetics of Yangochiroptera - abstract

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• Draft Plan of Action for Eurasian Subregional Partnership | ECFS
• Director | ECFS
• Forums | ECFS

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>4) - getmedia.msu.ru/ )