... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
... On-line консультант . ... Анонсы Спецкурс компании SAS Institute Inc. Аналитическое программное обеспечение SAS (SAS Analytics software)' . Курс читается сотрудникам Учебного центра и департамента Аналитики компании SAS Institute, Moscow, а также преподавателями ВМК МГУ . ... Инструменты и методы анализа временных рядов и эконометрических данных большого объема и сложной структуры: SAS Forecast server, библиотека SAS Econometrics and Time Series Analysis. ... Copyright ВМиК МГУ , 2008 . ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
PRESS RELEASE August 20, 2007 Gran Sasso performs a cat scan of the Sun The international experiment Borexino, which is being conducted at the underground laboratories of the Istituto Nazionale di Fisica (INFN, Italy's National Institute of Nuclear Physics) in the Gran Sasso massif, has observed extremely low-energy neutrinos emanating from the Sun, at a rate of dozens events a day. ... These reactions can only be studied by observing the neutrinos that they emit. ...
[
Текст
]
Ссылки http://rtm-cs.sinp.msu.ru/rtm_news/borexino20.08.2008_eng.pdf -- 136.3 Кб -- 24.01.2008 Похожие документы
DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...
Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...
Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...
... UHECR SINP MSU . ... TUS . ... mini-EUSO (UV atmosphere) . News . UHECR news . TLE news . Lab's news . Publications . Publications UHECR . ... For students . Our students . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . JEM-EUSO Extreme Universe Space Observatory on the Japanese Experiment Module (JEM) of the International Space Station . ... JEM-EUSO is a new type of observatory that uses the earth's atmosphere as a detector. ...
_________________________________________________________________________________________________ HIGH-FREQUENCY HYDRO ACOUSTIC SIGNALS (40 110 HZ), PRECEDING EARTHQUAKES , ON THE PACIFIC SHELF OF THE KAMCHATKA PENINSULA Victor E. Morozov P. P. Shirshov Institute of Oceanology, Russian Academy of Sciences, Moscow, Russia E-mail: rdfrmoroz@mail.ru ABSTRACT The local Kamchatka earthquake catalogue data and ... No micro earthquakes were recorded only in the second, which was not followed by EQ. ...
Lomonosov project . ... Personnel . ... Affiliation D.V. Skobeltsyn Institute of Nuclear Physics of M.V. Lomonosov Moscow State University . ... Phone 7 495 939 1818 . ... Phone 7 495 939 5731 . ... Phone 7 495 939 1010 . Fax 7 495 939 0896 . ... Affiliation Moscow State University, Sternberg Astronomical Institute . ... Fax 7 495 939 5063 . ... Institute for Biomedical Problems of the Russian Academy of Sciences, Skobeltsyn Institute of Nuclear Physics of Moscow State University. ...
Space Weather . ... Analysis . ... Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. ... Irina Myagkova, PhD, senior researcher - scientific analysis and modeling . ... Sergey Dolenko, PhD, senior researcher - adaptive methods of data prediction and analysis . ... Wera Barinova, junior researcher, senior programmer - programming . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...
The Department of Talented Youth Affairs and Professional Orientation . ... Olympiads . ... The first stage of the selection round for ?Lomonosov? Olympiad in mathematics, literature, geography, history and philosophy has started today. The selection round of the Olympiad is held in absentia with the use of distance learning technologies. ... For more details visit the portal of the Olympiad: http://olymp.msu.ru . ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
... Further processing Only 3N events of «good» runs of previous analysis are selected: 3N triggered events exist in every run Better accordance with MC for rates 150kHz (see elog 548 by Colas) GC triggered events excluded AaFit: -6.5 (Vladimir's presentation explains reason) Zenith angle 20° (in order to look only at events with vertical tracks) After 2008 2009 2010 all fi year year year ltres: -- 0.83107 -- 0.77107 -- 1.04107 - No evidence of possible anisotropy either. ...
[
Текст
]
Ссылки http://antares.sinp.msu.ru/docs/Gracheva_Bamberg_22.09.11.pdf -- 291.6 Кб -- 16.12.2013 Похожие документы
Two ivy (Hedera L., Araliaceae) species from the classic and geometric morphometrics points of view A. 1 2 1,2 Shipunov , D. Vasjukov , E. 2 2 Kost and V. 2 Rudakova Institute of Information Technologies, Moscow, Russia, plantago@herba.msu.ru Moscow South-West High School, Moscow, Russia Introduction Two ivy species from Russia and Ukrainia, Hedera helix L. ( Fig . 1) and H. colchica (C. Koch) C. Koch ( ... Fig. ... For the TPS analysis, we used the tpsRelw software (Rohlf, 2004). ...
... Профессоры кафедры . ... Кафедра математического анализа создана в 1933 году вместе с созданием механико-математического факультета. ... Кафедра обеспечивает преподавание базового двухгодичного курса математического анализа студентам первого и второго курса механико-математического факультета, курса анализа студентам химического факультета, курса высшей математики студентам географического факультета, биологического факультета, факультета почвоведения, факультета фундаментальной медицины. ...
О кафедре . Сотрудники . ... Публикуем материалы сотрудников кафедры . ... Кафедра математических и компьютерных методов анализа создана приказом ректора МГУ в 2008 году. ... Сотрудники кафедры проводят научные исследования в следующих областях: аналитическая теория чисел, математический анализ, теоретико-числовые методы в криптографии, сложность вычислений, компьютерная криптография, компьютерная геофизика. ... 2016, Кафедра математических и компьютерных методов анализа. ...