... Department . ... Courses . ... Course Name . ... Prof. Fedor S. Zaitsev . ... Prof. Alexander M. Popov . Visualization in Scientific Research . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Vladimir V. Nefedov . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Prof. Alexander P. Smirnov . Two-Dimensional Problems of Mathematical Physics . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>19) - ani.cmc.msu.ru/ )

• Department of the Automation for Scientific Research CMC MSU | Computational
• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the
• Prof. Dmitry P. Kostomarov at the Differential Equations and Topology

... Department of Vertebrate Zoology . Department of Vertebrate Zoology is one of the oldest departments of the Biological Faculty of Lomonosov Moscow State University. ... The students improve their practical skills in the courses of Microtechniques, Computer Methods in Biology and Methods of Field Research. ... The Department includes five research laboratories. ... Laboratory of Vertebrate Behaviour conducts research on the development of behavioural interactions in the higher vertebrates. ...

Еще в разделе: (Показать все результаты (>620) - vertebrata.bio.msu.ru/ )

• Выступления студентов и аспирантов на конференциях
• Student Reports at International Conferences
• Sergei V. Ogurtsov

. Русский . MCE-2016 . About Conference . Questions and Answers . Publications . Photogallery . Flash . HTML . Website creators . Contacts . Login: . Password: . Remember . Register . ! . Вопросы и ответы .

Еще в разделе: (Показать все результаты (>231) - www.mce.biophys.msu.ru/ )

• Gallery (HTML version)
• The dissertations didital library of the RSL: problems and solutions

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Site navigation: . ... Publications . ... SPDC Laboratory . ... This website uses Javascript for many elements such as the menus and page customization. ... Using a clever design of polarization optic, Italian researchers have successfully created four-level 'ququart' quantum states using the polarization and orbital angular momentum of single photons. ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...

Еще в разделе: (Показать все результаты (>125) - qi.phys.msu.ru/ )

• LabSite Error :: Quantum Information Laboratory

Home News News . ... QFTHEP'2015 Scientific Programme . ... If you missed the deadline but wish to participate, please contact the Organizing Committee by e-mail. ... e-mail: This e-mail address is being protected from spambots. ... 3550 roubles (approx. 64 / EUR 59)/ night . ... 3125 roubles (approx. 56 / EUR 52)/ night per person . ... Room reservations should be made via the Organizing Committee by sending an email to the address This e-mail address is being protected from spambots. ...

Еще в разделе: (Показать все результаты (>112) - qfthep.sinp.msu.ru/ )

... Scientific laboratories . ... Head of the laboratory: Gorkov Valery, Senior Research Fellow, PhD Contact information . ... loz@cmc.msu.ru . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, rooms 719 (Head of the laboratory), 720, 729 . ... The Laboratory of Inverse Problems was established in 1996 through integration of two laboratories: the lab of Mathematical methods of structural analysis and the lab of Methods for automation of an experiment. ...

Еще в разделе: (Показать все результаты (>133) - en.cs.msu.ru/ )

• Research Laboratory of Computational Modeling Tools | CMC MSU
• Laboratory of Inverse Problems
• International Scientific Conference "Probability Theory and its Applications"

... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...

Еще в разделе: (Показать все результаты (>26) - dynamo.geol.msu.ru/ )

. Frames are requied

Еще в разделе: (Показать все результаты (>3) - www.radio-msu.net/ )

• WWW Search

.

Еще в разделе: (Показать все результаты (>17) - www.chemport.ru/ )

Домой :: Семинар по физике полимеров :: 1999 . ... S.S. Sheiko (Lab. of Organic Chemistry/Macromolecular Chemistry, University of Ulm). ... A. N. Ivanova, L. I. Manevich (Institute of Problem of Chemical Physics). ... S. I. Kuchanov, T. S. Zharnikov (Institute of Applied Mathematics, RAS, Moscow). ... S. G. Skuridin (Institute of Molecular Biology, RAS, Moscow). ... Prof. N. G. Korotkiy (Russian State Medical University) . ... 304. 6 мая: V.I.Volkov (Institute of Crystalography, RAS, Moscow) . ...

Еще в разделе: (Показать все результаты (>210) - polly.phys.msu.ru/ )

• International Workshop "Theory and Computer Simulation of Polymers: New
• Publications
• Mike Thamm - homepage

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>7) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/rustexeo.html

The Chair of Mathematical Theory of Intelligent Systems and . Laboratory of Problems of Theoretical Cybernetics . ... MaTIS Chair . ... Research . ... Computer Solver . development of the Automatic solver of mathematical problems . ... Search in Databases . ... Here is a lecture notes in Russian by A.S. Podkolzin " Computer modeling by mathematical problems solving ". ... The Chair of Mathematical Theory of Intelligent Systems, Laboratory of Problems of Theoretical Cybernetics . ...

Еще в разделе: (Показать все результаты (>141) - www.intsys.msu.ru/ )

• Intelligent Systems :: Magazine
• Intelligent Systems :: Science :: Conference
• Intelligent Systems :: Magazine :: Web archive :: Volume 15, issue 1-4, 2011

Wireshark · · · · · (Win, Mac, Linux) Open Source (http://www.wireshark.org) · · · ( ) · 2 1 · # usermod ­a ­G wireshark user · wireshark root user@host:~$telnet ya.ru 80 Trying 213.180.193.3.. ... MAC 2. MAC IP ARP 3. L4 Interface # 1 2 3 4 Domain # 1 1 Eth Address 00:00:00:00:00:0a 00:00:00:00:00:09 IPv4 Address 10.0.1.2 10.0.1.1 10.0.2.2 10.0.0.3 Flow # 1 2 Src Itf # 1:49153 3:49153 Dst Itf # 4:234 1:432 Protocol TCP UDP Edges 1-2 1-2 .. ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/4-5utils.pdf
• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

Peer-review policies of the journal "Vestnik Moskovskogo Universiteta. ... Antropologia» Authors submit their manuscripts in printed format (2 copies) together with the electronic version ("*.rtf") on CD/DVD and via email. ... 11, Research Institute and Museum of Anthropology, Lomonosov Moscow State University, Deputy Editor of the journal "Vestnik Moskovskogo Universiteta. ... It is obligatory that the Editors send to authors copies of the reviews or motivated rejection of the manuscripts. ...

Еще в разделе: (Показать все результаты (>21) - www.anthropos.msu.ru/ )

... CVS . ... ASM Kislovodsk . ... Anonymous CVS access through CVS protocol: . cvs -d :pserver:anonymous@curl.sai.msu.ru:/srv/cvs/cvsroot . Anonymous CVS browse through ViewVC: . ... Rs485 CVS . ... ASM Dome demon CVS . ... CVSROOT at curl.sai.msu.ru is located in /srv/cvs/cvsroot . You may access to CVS repository via SSH only using your curl's account login/password. ... export CVSROOT=curl.sai.msu.ru:/srv/cvs/cvsroot . ... CVS_RSH=ssh cvs -d user@ curl.sai.msu.ru:/srv/cvs/cvsroot command . ...

Еще в разделе: (Показать все результаты (>23) - curl.sai.msu.ru/ )

• atmos 3.0 page

... List of participants . ... Academician of NAS of Belarus, Professor, Institute for Problems of Natural Resources Use and Ecology . ... Professor, Laboratory of Geoenvironmental Science and Engineering, Cornell University . ... Professor, Dept. of Soil Science and Agrochemistry, Rostov State University . ... Senior Scientist, Dept. of Chemistry, Div. of Organic Chemistry, Lomonosov Moscow State University . ... Professor, Head of Soil Chemistry Chair, Dept. of Soil Science, Moscow State University . ...

Еще в разделе: (Показать все результаты (>98) - mgumus.chem.msu.ru/ )

SPAW Editor PHP Edition version 1.0.6 Release Notes Thanks to everyone who downloaded, tried and supported SPAW Editor! This release includes several new features: css classes for tables, background images in tables and table cells, improved link dialog and more. ... If you are fluent in any of languages that are now included and see any typos or mistakes please report to spaw@solmetra.com Happy editing, Alan Mendelevich a.k.a. ailon alan@solmetra.com ...

Еще в разделе: (Показать все результаты (>6) - textbook.sinp.msu.ru/ )

• SPAW Editor documentation

Graded Versions of Goldie's Theorem / Kanunnikov A.L. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>210) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Vestnik
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 3/2011