LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ HYDROACOUSTIC ANTENNA : A POWERFUL TOOL TO FORECAST TSUNAMIGENIC EARTHQUAKES Yakov S. Karlik Central Research Institute MORPHYSPRIBOR , 46 Chkalovsky proezd, Sankt-Petersburg, 197378 Russia E-mail: karlik@mail.cl.spb.ru ABSTRACT Hydroacoustic antenna ... 2001). ... Eiby, J.A., 1982: Earthquakes. ...

Еще в разделе: (Показать все результаты (>23) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E12_Marchuk.pdf

Status of mTCA Slow Control development at CMS Petr Volkov Lomonosov Moscow State University Skobeltsyn Institute of Nuclear Physics, Russia 6/27/2015 P. Volkov SINP MSU 1 uTCA: Introduction MicroTCA® - open standard for fabric computer systems. MicroTCA systems are both physically small and non-expensive. ... Use PVSSII and the JCOP Framework to develop your control applications. These are the official CMS DCS developing tools. ... CMS_MTCA_HCALTR_CRATE1 CRATES.. ...

Еще в разделе: (Показать все результаты (>151) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf
• http://qfthep.sinp.msu.ru/talks/qfthep10_levchenko.pdf

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>11) - lvk.cs.msu.su/ )

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>19) - engineering.phys.msu.ru/ )

• Parallel Programming
• Introduction to Linux

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>18) - lcc.chem.msu.ru/ )

. Moscow State University . Physics Department . Russian Academy of Sciences . Institute of Organoelement Compounds . Language: . RUS / ENG . Source: russia.ru, 09.2008 . Source: russia.ru, 09.2008 . The news are available in Russian only . Seminar of the Polymer Council of RAS . Seminar in Polymer Physics . Seminar in Electrochemistry

Еще в разделе: (Показать все результаты (>242) - polly.phys.msu.ru/ )

• Science
• International Workshop "Theory and Computer Simulation of Polymers: New
• Polymers with Associating Groups (experiment + theory + computer experiment) -

... Take latest Pacman and install it : Create somewhere directory software/ and simply untar Pacman there : cd software wget http://physics.bu.edu/pacman/sample_cache/tarballs/pacman-latest.tar.gz tar xzf pacman-latest.tar.gz # It will be created, for example, directory pacman-3.21/ rm -f pacman-latest.tar.gz ln -s pacman-* pacman cd pacman source setup.csh # or setup.sh cd .. ... For instance, if you do pacman -allow tar-overwrite this setting remains as a default until you change it. ...

Еще в разделе: (Показать все результаты (>16) - lhe.sinp.msu.ru/ )

List of available DNA-protein and RNA-protein complexes . List of Pfam domains presented in DNA-protein and RNA-protein complexes . List of SCOP domains presented in DNA-protein and RNA-protein complexes . ... Amino acid code changer : 3-letter code to 1-letter code and vice versa . The work is supported by the Russian Foundation of Basic Research, grants 06-07-89143 and 06-04-49558, and INTAS, grant 05-1000008-8028 ...

Еще в разделе: (Показать все результаты (>5455) - monkey.belozersky.msu.ru/ )

• About this project
• Search for potential water bridges between protein and nucleic acid
• DNA/RNA-Protein structures

.

Еще в разделе: (Показать все результаты (>49) - lav01.sinp.msu.ru/ )

University Satellites and . Space Science Education . ... The purpose of the developed scientific - educational program complex is creation on the Earth on the base of telemetry data of virtual model of microgravitational environment in which experiments are carried out, and virtual motion model of of the space vehicle. ... The developed program complex concerns to the class of the distributed program systems. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>59) - cosmos.msu.ru/ )

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>25) - nano.msu.ru/ )

• International School ?Computer simulation of advanced materials?, 16?21 July
• Registration for the International School ?Computer simulation of advanced

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>17) - polit.msu.ru/ )

• Новости факультета

... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...

Еще в разделе: (Показать все результаты (>3) - phys.msu.su/ )

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>10) - tex.bog.msu.ru/ )

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Departments . ... Field training . ... The department curriculum is focused on preparation of experts of the top skills in the field of tourist business, tourist service, the government in tourism sphere. ... A theme of scientific work of department Territorial touristic-recreational systems: natural and social and economic preconditions of a sustainable development includes three underthemes. ...

Еще в разделе: (Показать все результаты (>49) - eng.geogr.msu.ru/ )

• Department of Cartography and Geoinformatics
• Undergraduate study
• Department of Oceanology

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

International Laser Center of MSU . ... Scientific Laboratories . Science . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Science and education Scientific Laboratories Laboratory of computer simulations in optics . ... Dergachev Aleksandr Aleksandrovich Ph.D. Dormidonov Aleksandr Evgen'evich Ph.D. Kandidov Valeriy Petrovich Doctor of science . ... Femtosecond Nonlinear Optics of High Power Laser Radiation . Femtosecond TW Laser Pulse Filamentation in Gases and Condensed Media . ...

Еще в разделе: (Показать все результаты (>191) - ilc.phys.msu.ru/ )

• "Computers and measurements" practical course laboratory

... class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 7 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p2 # , p1 def proximity(self, p1, p2): # in bool # self.edges[p1] p2 return p2 in self.edges[p1] 3.1.1.2. . class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p # , p def neighborhood(self, p): return self.edges[p] . ...

Еще в разделе: (Показать все результаты (>7) - compmech.math.msu.su/ )

О кафедре . Сотрудники . ... Публикуем материалы сотрудников кафедры . ... Кафедра математических и компьютерных методов анализа создана приказом ректора МГУ в 2008 году. ... Сотрудники кафедры проводят научные исследования в следующих областях: аналитическая теория чисел, математический анализ, теоретико-числовые методы в криптографии, сложность вычислений, компьютерная криптография, компьютерная геофизика. ... 2016, Кафедра математических и компьютерных методов анализа. ...

Еще в разделе: (Показать все результаты (>2) - mkma.math.msu.su/ )

Программные средства построения интернет-атласов . ... В работе описывается разрабатываемая в НИВЦ МГУ технология и поддерживающие ее программные средства комплексного отображения разнородной пространственно распределенной информации, в том числе в среде Интернет. ... Описываемая технология состоит в подготовке на инструментальной машине файлов (HTML-страниц, файлов с программами управления данными и их визуальным представлением и файлов данных), представляющих собой Интернет публикацию. ...

Еще в разделе: (Показать все результаты (>18) - adept.srcc.msu.ru/ )