.

Еще в разделе: (Показать все результаты (>50) - www.chemport.ru/ )

• "Phd in computational chemistry (cyprus eu)" - вакансия в разделе "Работа для

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>3) - www.eng.geogr.msu.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>46) - eng.geogr.msu.ru/ )

• Department of Cartography and Geoinformatics

... IPI-1D is a set of programs for processing and interpretation of VES data within the framework of horizontally layered models . ... Except programs already listed above, our specialists developed some programs for modeling, studying, visualization and interpretation of resistivity data in anisotropic media (anisotropic halfspace, horizontally layered media with anisotropic basement and vertical contact of two anisotropic media). ...

Еще в разделе: (Показать все результаты (>64) - geophys.geol.msu.ru/ )

• Theory of resistivity sounding
• Software for resistivity and induced polarization
• Near-surface electrical prospecting laboratory at Moscow University

... Second-year students classes . ... The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... As a result, by the and this course, students acquire knowledge about the popular parallel programming techniques, knowledge of modern high-performance computing systems and practical skills to work with them. ... Moscow: Binom...

Еще в разделе: (Показать все результаты (>23) - engineering.phys.msu.ru/ )

... Publications :: Differentiated Sills . ... Ariskin A.A., Barmina G.S., Frenkel M.Ya., Nielsen R.L. COMAGMAT: a Fortran program to model magma differentiation processes. ... Ariskin A.A., Barmina G.S. COMAGMAT: Development of a Magma Crystallization Model and Its Petrological Applications. ...

Еще в разделе: (Показать все результаты (>585) - geo.web.ru/ )

• "Введение в криптографию" под редакцией В.В.Ященко - Все о Геологии (geo.web...
• COMAGMAT MODEL
• Pletchov Pavel biography info

... 3] ISO/IEC DTR 14252, Portable Operating System Interface for Computer Environments - POSIX. ... 4] Final DISP for FDISP 15287.02 - Information technology - Portable Operating System Interface (POSIX) - Standardized Application Environment Profile - POSIX Realtime Application Support (AEP). ... 7] ISO/IEC 9945-1:1990 (IEEE Std 1003.1-1990), Information technology -- Portable Operating System Interface (POSIX) -- Part 1: System Application Program Interface (API) [C Language]). ...

Еще в разделе: (Показать все результаты (>233) - oit.cmc.msu.ru/ )

• Часть V - Литература
• Program Execution functions
• Mathematical Functions

... Moscow State University . ... Research . ... Professor, Dept. of Computation Mathematics and Computer Science, . Kuban State University . ... Evgeny A. Demekhin obtained his Diploma (1972) from the Kuban State Technological University and his Ph.D. (1981) from the M.V.Lomonosov Moscow State University. From 1981 to 1984 he was a Postdoc at the Kuban State Technological University, and from 1984 to 1991 he has been working at the Oil Research Institute at Krasnodar as a research fellow. ...

Еще в разделе: (Показать все результаты (>53) - nanofluidics.phys.msu.ru/ )

• Olga I. Vinogradova
• Maduar
• Vardan O. Vardanyan

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>112) - scon155.phys.msu.su/ )

... Department . ... Courses . ... Course Name . ... Prof. Fedor S. Zaitsev . ... Prof. Alexander M. Popov . Visualization in Scientific Research . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Vladimir V. Nefedov . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Prof. Alexander P. Smirnov . Two-Dimensional Problems of Mathematical Physics . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>16) - ani.cmc.msu.ru/ )

• Courses
• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the
• Department of the Automation for Scientific Research CMC MSU | Computational

... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...

Еще в разделе: (Показать все результаты (>19) - dynamo.geol.msu.ru/ )

• Professional experience of V.Zakharov

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes