Prediction of the bacterial promoter regions by DNA electrostatic properties Temlyakova E.A., Sorokin A.A. Institute of Cell Biophysics RAS, Pushchino, Russia, evgenia.teml@gmail.com Electrostatic potential is the only property of a macromolecule that can influence other molecules over distances above 5. ... The database of promoter electrostatic profiles for fast comparison of the DNA sequences to experimentally identified promoters by similarity of their electrostatic profiles has been created. ...

Еще в разделе: (Показать все результаты (>233) - mccmb.belozersky.msu.ru/ )

• OMICS Startup Contest

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... ELFIN-L . ... It consist of a Flux Gate Magnetometer (FGM), an Energetic Particle Detector for Electrons (EPDE), and an Energetic Proton Detector for Ions (EPDI). ... Energetic particles create a hazardous environment for satellites and humans in space and cause a number of satellite failures. ... Magnetospheric particles and radiation environment . ...

Еще в разделе: (Показать все результаты (>42) - lomonosov.sinp.msu.ru/ )

• Lost Password | Университетский спутник "Ломоносов"
• DEPRON | Университетский спутник "Ломоносов"
• TUS | Университетский спутник "Ломоносов"

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>24) - observ.pereplet.ru/ )

• Results.html

... Scientific laboratories . ... Head of the laboratory: Leonov Michael, Leading Research Fellow, PhD Contact information . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, rooms 654 (Head of the laboratory), 655 . ... The Laboratory of Computational Practice and Information Systems was created in 1988 as a result of integrating two other laboratories: the Laboratory of Computational Practice Support Tools and the Laboratory of Dialogue Information Systems. ...

Еще в разделе: (Показать все результаты (>96) - en.cs.msu.ru/ )

• Laboratory of Ternary Informatics
• Laboratory of Computational Practice and Information Systems
• Laboratory of Programming Technologies

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ HYDROACOUSTIC ANTENNA : A POWERFUL TOOL TO FORECAST TSUNAMIGENIC EARTHQUAKES Yakov S. Karlik Central Research Institute MORPHYSPRIBOR , 46 Chkalovsky proezd, Sankt-Petersburg, 197378 Russia E-mail: karlik@mail.cl.spb.ru ABSTRACT Hydroacoustic antenna ... 2001). ... Eiby, J.A., 1982: Earthquakes. ...

Еще в разделе: (Показать все результаты (>22) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E12_Marchuk.pdf

sparallel.ru . Older posts . Newer posts . Posted by admin . ... Continue reading . Posted in Разное . Мар 17 . ... В интернет-магазине Cityboots представлена последняя коллекция обуви от Fabi по доступной цене. ... Posted in Ботинки . ... Широко известный канадский бренд бюджетной мужской и женской обуви. ... Posted in Кросовки . ... Posted in Сандалии . ... совокупный доход, получаемый этими ?обуви? или ? ... Экологически чистая обувь, обувь которая ?дышит? ? ... обувь изо льна. ...

Еще в разделе: (Показать все результаты (>4) - sparallel.ru/ )

• sparallel.ru - Part 106

Events About Structure . At the X Congress of the Russian Union of Rectors the President of RUR V.A. Sadovnichy suggested the creation of interactive inter-university scientific and educational project "University Department" . ... In 2015, as part of the National Strategy of actions in interests of children the Interdisciplinary Research and Education Center for Childhood Fundamental Studies was created in the Human Research Institute of Moscow State University . ...

Еще в разделе: (Показать все результаты (>40) - www.rsr-online.ru/ )

• RSR online

Nowadays one of the pronounced tendencies in the language policy (language plannin g) of all English-speaking countries is the development and wide spreading of the so-called inclusive language based on the principle of political correctness. ... 1990. ... Buffalo, 1995. . ... inclusive language). " " . ... father, son, son of man, man, brother .. he they. ... URL: http:/www.academia.org/lectures/lindl.html ( : 15.04.2008). ... URL: http://www.cbmw.org/Resources/Articles ( : 19.12.2011). , , , , , , . ...

Еще в разделе: (Показать все результаты (>107) - ffl.msu.ru/ )

• About Us

Supernova 2001V in NGC 3987 . This page is devoted to information on Supernova 2001V in NGC 3987 Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main page . Information on the original web pages for many of these images can be found on the Supernova links web page. ... Rafael Ferrando has created an animated GIF of this supernova from all of the images he has made. ( local mirror ) . ... 2001/02/18.099 . ... Cedric Leyrat image . ...

Еще в разделе: (Показать все результаты (>108) - www.rochesterastronomy.org/ )

• Supernova 2000dm in UGC 11198
• Supernova 2000cn in UGC 11064
• Supernova 2000ck in IC 4355

MSU . Science Park . ... Prototyping center . Engineering formula . ... Center for Youth Innovation Creativity and Prototyping at Moscow State University Science Park is focused on work with pupils and students to familiarize them with the capabilities of modern equipment and engaging in scientific and technical activities. ... The main goal of the Center - provide opportunities for children and young people to fulfill themselves in scientific and technical work. ... JSC "MSU Science Park" . ...

Еще в разделе: (Показать все результаты (>12) - www.sciencepark.ru/ )

• MSU Science Park - News
• MSU Science Park - Projects & Partners

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>54) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/shevnin/publ/117.pdf
• http://geophys.geol.msu.ru/STUDY/manual/ip1dmine.doc
• http://geophys.geol.msu.ru/shevnin/publ/175.pdf

... User account . Create new account (active tab) . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. ... Language settings . Language . ... This account's default language for e-mails. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• Opening of the educational programme - School of CEOs, "Capsule of security"
• Admission committee | MSU Higher school of management and innovation
• School overview | MSU Higher school of management and innovation

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>5) - psyberlink.flogiston.ru/ )

Department of Ancient Languages . ... The department's staff members teach Latin for students of the history and law faculties, Latin and Greek for students of the faculty of philosophy's department of religious studies, and also teach Latin and Ancient Greek to students and post-graduate students in the departments of ancient history, Medieval history, history of southern and western Slavs, archaeology, and the department of art history and the theory of art history. ...

Еще в разделе: (Показать все результаты (>37534) - hist.msu.ru/ )

• Department of Russian History of the 20th Century
• Center for Ukrainian and Belorussian Studies, Faculty of History, Moscow State
• The Rural Roads as the Structural Element of the Roman Organization of Land

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>14) - heritage.sai.msu.ru/ )

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>23) - rswater.phys.msu.ru/ )

Sign in Register . ... Resources . ... Forums . ... 495) 3334-65-56 . info@ecfs.msu.ru . All contacts . ... Home Forum . ... Search in section Everywhere Основная дискуссия -Ongoing consultations/ Текущие онлайн конференции -Прошедшие онлайн конференции -Общая дискуссия -Евразийское почвенное партнерство . ... Основная дискуссия . Ongoing consultations/ Текущие онлайн конференции . ... Прошедшие онлайн конференции . ... Общая дискуссия . ... The Department of land resources . ... Forum . ...

Еще в разделе: (Показать все результаты (>21) - ecfs.msu.ru/ )

• Ongoing consultations/ Текущие онлайн конференции | ECFS
• Draft Plan of Action for Eurasian Subregional Partnership | ECFS

. Veronika K. Laurinavichyute . /Lunina/ . Senior Scientific Researcher, PhD . CV . Selected Publications . News: . 12.08.2013. - Page updated 20.07.2013. - Project GRAVITSAPA started 01.07.2013. - Published: Practical exercises in physical chemistry. MGPU. Part 2. 2013 16-21.06.2013. - Workshop on composite materials, Harbin 10.04.2013. - On-line publication: Electrochimica Acta (2013), pp. 102-107 23.03.2012. - Website created! . nika@elch.chem.msu.ru . +7(495)939-1321 . Back

Еще в разделе: (Показать все результаты (>65) - electr003.chem.msu.ru/ )

• Boris B. Damaskin

... THE LJUBLJANA SUMMER SCHOOL 2006 . ... THE LJUBLJANA SUMMER SCHOOL 2006 is a new intensive programme open to both undergraduate and graduate students of Business, Economics, and other fields of Social Sciences. The programme was created at the Faculty of Economics in Ljubljana in order to impart knowledge by taking full advantage of our country s unique geographical position: the meeting point of East and West. ... The Summer School s aim is to learn by applying knowledge to real-life situations. ...

Еще в разделе: (Показать все результаты (>81) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова
• Преподаватель ВШБ МГУ Вячеслав Болтрукевич выступил на конференции EFMD
• Конкурс на лучшее эссе года