. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>4) - apollo.sai.msu.ru/ )

Experience with OO Database for CMS Events Distributed Between Two Sites. ... Participation of Russian institute (5% of all CMS simulations): Spring 2000 year - SINP MSU + ITEP - 50000 events , 25 GB transferred to CERN Autumn 2000 year - SINP MSU + ITEP + JINR - 110000 events , 180 GB transferred to CERN Autumn 2001 year - ( SINP +RRC)+ ITEP + JINR +FIAN - 270000 events , OO Database distributed between SINP and ITEP ~200 GB ...

Еще в разделе: (Показать все результаты (>72) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/shawhan/shawhan_plenary.pdf
• http://acat02.sinp.msu.ru/presentations/perret-gallix/ACAT2002.doc
• http://acat02.sinp.msu.ru/presentations/ratnikova/01.pdf

... Creation of catalytically active particles from enzymes crosslinked with a natural bifunctional agent--homocysteine thiolactone. ... The current study describes an approach to creation of catalytically active particles with increased stability from enzymes by N-homocysteinylation, a naturally presented protein modification. ... Modification of these proteins concerns the accessible lysine residues and introduces an average of 2-2,5 homocysteine residues per protein monomer. ...

Еще в разделе: (Показать все результаты (>78) - biochem.bio.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

... Next: Scale Adjustment Up: Data Processing Functions (Mathematics Previous: Data Processing Functions (Mathematics Contents Index . Figure 3.9: Macrocommands Window. Macros may be created and controlled using Menu Command Mathematics/ Macros.. ... A set of possible commands and corresponding Buttons (as they appear at Tool Bar) can be seen at the left panel. ... The name of the Macros associated with button on the Tool Bar is shown in the upper line of the panel. ...

Еще в разделе: (Показать все результаты (>119) - www.spm.genebee.msu.ru/ )

• Server
• Hysteresys calibration file generation
• FemtoScan Online FAQs

. Moscow State University . Physics Department . Russian Academy of Sciences . Institute of Organoelement Compounds . Language: . RUS / ENG . Source: russia.ru, 09.2008 . Source: russia.ru, 09.2008 . The news are available in Russian only . Seminar of the Polymer Council of RAS . Seminar in Polymer Physics . Seminar in Electrochemistry

Еще в разделе: (Показать все результаты (>398) - polly.phys.msu.ru/ )

Excitation of low-level nuclear state 14.4 keV 57Fe by radiation of plasma created by the powerful femtosecond laser pulse Golovin Grigoriy Vladimirovich, Mikheev Pavel Mikhailovich Diploma thesis abstract The conversional decay of excited nuclei (57Fe, E=14.4 keV) was investigated. ... The diagnostics of plasma lets us to appreciate the temperatures of "hot" electrons and x-ray radiation as 13 ± 2 keV. ... In measured spectrums there are maximums on the energy of conversional electrons. ...

Еще в разделе: (Показать все результаты (>235) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2013/Solyankin_Angelutc_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2011/Mukhin_Shkurinov_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2009/Indukaev_Priezzhev_en.pdf

List of available DNA-protein and RNA-protein complexes . List of Pfam domains presented in DNA-protein and RNA-protein complexes . List of SCOP domains presented in DNA-protein and RNA-protein complexes . ... Amino acid code changer : 3-letter code to 1-letter code and vice versa . The work is supported by the Russian Foundation of Basic Research, grants 06-07-89143 and 06-04-49558, and INTAS, grant 05-1000008-8028 ...

Еще в разделе: (Показать все результаты (>804) - monkey.belozersky.msu.ru/ )

• About this project

.

Еще в разделе: (Показать все результаты (>56) - lav01.sinp.msu.ru/ )

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>62) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/literature/WOS.pdf

... Inorganic Materials Sciences . ... At the same time at the Faculty of Physics and Mathematics of the Moscow University was founded the Inorganic Chemistry Division which was later transformed into a separate Department of Inorganic Chemistry of the MSU Faculty of Chemistry . ... The latter part of this program is successfully realized at both the Deartment and at the Department of Materials Sciences , the new faculty of MSU, which creation was initiated by the department of Inorganic Chemistry. ...

Еще в разделе: (Показать все результаты (>64) - www.inorg.chem.msu.ru/ )

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>4920) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Relational ENSDF

Главная Программы Магистратура Программа "Международный бизнес и стратегия" Курсы по выбору МА13 Весна 2013 . International Marketing (Abdolreza Eshghi) . ... Global marketing\'s main job is to create customer value in the global marketplace. This intensive seminar focuses on how managers evaluate global market opportunities and develop market entry and expansion strategies in order to create customer value on a global basis. ... Business Ethics (Gerald Rohan) . ...

Еще в разделе: (Показать все результаты (>136) - www.mgubs.ru/ )

• The Ljubljana Summer school

Laboratory of Informatics . Head of Laboratory E.S.Polischuk, senior researcher, DSc . ... research guidance of a four year student's project in the Faculty of Geography (N.M. Chernavskaya, DSc) . ... Grant of RFBF (Russian Foundation for Basic Research) 01-03-00332, the head of the project prof. R.B.Rybakov, Institute of Orientalistic (Russian Academy of Science), N. M. Chernavskaya - performer . ... N.M.Chernavskaya, DSc, senior researcher, T.B.Pleskacheva., DSc, senior researcher. ...

Еще в разделе: (Показать все результаты (>182) - srcc.msu.ru/ )

• Laboratory of Systems for Automated Image Processing
• A.Romanov, Z.Fattakhova, D.Zhigunov, V.Korchak, V.Sulimov // On the origin of
• Alexey N. Romanov, Zukhra T. Fattakhova, Denis M. Zhigunov, Vladimir N.

... 2 What is MATLAB ?? Basic Matrix Operations Script Files and M-files Some more Operations and Functions APPLICATIONS: Plotting functions .. ... Vectors are special forms of matrices and contain only one row OR one column. Scalars are matrices with only one row AND one column MATLAB Matrices 17 A matrix with only one row AND one column is a scalar. A scalar can be created in MATLAB as follows: » a_value=23 a_value = 23 MATLAB Matrices 18 A matrix with only one row is called a row vector. ...

Еще в разделе: (Показать все результаты (>21) - imaging.cs.msu.ru/ )

Supernova 2001X in NGC 5921 . This page is devoted to information on Supernova 2001X in NGC 5921 Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main page . Information on the original web pages for many of these images can be found on the updates and links web pages. ... SNWeb has a 2001X page . ... 2001/03/02.386 . ... 15.2 . ... Arne Danielsen image . ... JM Llapasset image . ... vsnet-alert 5763 ] SN 2001X in NGC 5921 . ...

Еще в разделе: (Показать все результаты (>123) - www.rochesterastronomy.org/ )

• Supernova 2001V in NGC 3987
• Bright Supernovae pages - Updates 1998
• Supernova 2000ck in IC 4355

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>15) - www.issp.ac.ru/ )

• Chernogolovka

... Поиск по МГУ | Лента новостей | ... О проекте . ... Please, enter the code that you see below in the input field. This is for blocking bots that try to post this form automatically. If the code is hard to read, then just try to guess it right. If you enter the wrong code, a new image is created and you get another chance to enter it right. ... 2003 2011 MsuNews.Ru Новости МГУ . 2003 2011 Разработка и дизайн MMForce.Net . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>64) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ
• MsuNews.Ru | Блог проекта
• MsuNews.Ru | Энциклопедия

... Take latest Pacman and install it : Create somewhere directory software/ and simply untar Pacman there : cd software wget http://physics.bu.edu/pacman/sample_cache/tarballs/pacman-latest.tar.gz tar xzf pacman-latest.tar.gz # It will be created, for example, directory pacman-3.21/ rm -f pacman-latest.tar.gz ln -s pacman-* pacman cd pacman source setup.csh # or setup.sh cd .. ... For instance, if you do pacman -allow tar-overwrite this setting remains as a default until you change it. ...

Еще в разделе: (Показать все результаты (>17) - lhe.sinp.msu.ru/ )

Host: localhost Database: atomax2 --------------------------------------------------------- -- Server version 3.23.52-nt -- -- Table structure for table ' deliveries ' -- DROP TABLE IF EXISTS deliveries ; CREATE TABLE deliveries ( id_delivery int (11) NOT NULL auto_increment, subj varchar( 255 ) default NULL , author varchar( 255 ) default NULL , type tinyint (4) default ...

Еще в разделе: (Показать все результаты (>7) - textbook.sinp.msu.ru/ )

• http://textbook.sinp.msu.ru/modules/ax_visitors/visitors.mysql
• http://textbook.sinp.msu.ru/modules/ax_visitors/visitors.sql
• SPAW Editor documentation