Gauss-Laguerre Keypoints Descriptors for Color Images Andrey S. Krylov and Dmitry V. Sorokin Laboratory of Mathematical Methods of Image Processing, Faculty of Computational Mathematics and Cybernetics, Lomonosov Moscow State University, http://imaging.cs.msu.ru Email: {kryl, dsorokin}@cs.msu.ru Abstract--Keypoints descriptors construction algorithm for color images is introduced. ... V. C ONCLUSION Keypoints descriptors construction algorithm for color images was introduced. ...

Еще в разделе: (Показать все результаты (>137) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2008.cyprus.yurin_kravtsov.scripting.en.pdf
• http://imaging.cs.msu.ru/pub/2011.DSPA.Lubimov_Mikheev_Lukin.Clustering.en.pdf
• http://imaging.cs.msu.ru/pub/2007.CyberWorlds.Yurin_Volegov.Draft.en.pdf

... It operates with high efficiency inside a 1 T magnet in an intense charged particle beam of up to 3 в 106 particles/s. It uses a unique light collection system combining air space, wavelength shifter disc and conventional lucite light guides. ... Description of the counter The final CPVA counter is composed of a plastic scintillator, an air light guide, a wavelength shifter disc, lucite wave guides and two phototubes; their configuration and dimensions are given below. ... Optics of the CPVA counter...

Еще в разделе: (Показать все результаты (>61) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/nir/papers/NIM_3000-LGD.pdf

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

... We will dwell on linguistic aspects and Lexical Resources of POLITEXT branch having in mind some intermediate semantic representation of a whole text as the basis for differentiated Information Extraction. It is personal data (in the social sphere) recognition in texts that we focus on, see (Leontyeva et al. ... As the main instrument of semantic analysis of coherent texts this dictionary bears the important information on how to build BTF-units starting from lexemes of SemDict entries. ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Semantic Dictionary for Text Understanding and Summarization

Journal of Magnetism and Magnetic Materials 383 (2015) 110 ­113 Contents lists available at ScienceDirect Journal of Magnetism and Magnetic Materials journal h ome p age : www. e ls evier.c o m/locate/jmmm Transverse magneto-optical Kerr effect in 2D gold ­ garnet nanogratings A.V . Chetvertukhin a, A.I. Musorin a, T.V. Dolgova a, H. Uchida b, M. Inoue c, ... Large Q-factor of the resonance is attributed to the localisation of optical fields in the magnetic garnet film. ...

Еще в разделе: (Показать все результаты (>61) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/jap113_17a942_2013.pdf
• http://nanolab.phys.msu.ru/sites/default/files/dicnma13_56.pdf
• http://nanolab.phys.msu.ru/sites/default/files/acsphotonics.pdf

МГУ имени М.В.Ломоносова Русская версия . ... The beginning and end of the event . ... Africa /Abidjan Africa /Accra Africa /Addis_Ababa Africa /Algiers Africa /Asmara Africa /Bamako Africa /Bangui Africa /Banjul Africa /Bissau Africa /Blantyre Africa /Brazzaville Africa /Bujumbura Africa /Cairo Africa /Casablanca Africa /Ceuta Africa /Conakry Africa /Dakar Africa /Dar_es_Salaam Africa /Djibouti Africa /Douala Africa /El_Aaiun Africa /Freetown ... МГУ имени М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>9) - conf.msu.ru/ )

... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog The Team
• SAI OCL Catalog Berkeley 97
• SAI OCL Catalog Berkeley 71

О лаборатории . ... Лаборатория теоретической биофизики . ... The manual to FireFly program clearly explain why and how to use spherical or cartesian functions when working with different basis sets. ... The $D5 group provides further control through the D5, F7, and G9 keywords, which pertain to d, f, and g functions, respectively. ... Quantum chemistry information page ERG Research Group: Лаборатория теоретической биофизики написал (Май 19th, 2015 5:52 пп) . ... 2014 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>38) - erg.biophys.msu.ru/ )

• All-atom automatic OPLS-AA topology generator ERG Research Group: Лаборатория
• Visual approach to construction of &QMMM section of CP2K input file ERG
• cp2k ERG Research Group: Лаборатория теоретической биофизики

. Показ слайдов для альбома :: Защита дипломных работ 22.12.2008 . Показ слайдов . Fullscreen applet [Современные браузеры] [Совместимые, но с ограничениями] . Галерея: Список альбомов Альбом: Защита дипломных работ 22.12.2008 . If you don't have the Java Plugin 1.4 or later, or you don't want to wait for the applet to download, you can use one of the non-fullscreen versions. Your browser doesn't support applets; you should use one of the other slideshow methods. Powered by Gallery v1.4.3-RC3 .

Еще в разделе: (Показать все результаты (>45) - hep.msu.dubna.ru/ )

• Показ слайдов для альбома :: Cеминар Нобелевского лауреата по физике Дэвида
• Показ слайдов для альбома :: Экскурсия студентов третьего курса в Дубну. Осень
• Показ слайдов для альбома :: Картинки

... Магистерское образование . ... Enterprise Information Infrastructure . This course is focused on enterprise infrastructure and integration technology. Course presents different approaches to enterprise architecture and modern solutions of information infrastructure problems. Course?s topics cover strategies that help large enterprises to increase the agility of their IT systems. ... Enterprise portal technology, including collaboration and knowledge management . ... FI- Master data . ...

Еще в разделе: (Показать все результаты (>12) - hcs.cmc.msu.ru/ )

. The articles (in Russian) about scientific school on non commutative geometry and topology: . Presentation on the conference dedicated to 10th anniversary of RFDR, 16.10. 2002 Ц. Report on scientific results for the grant of the President of Russian Federation for support of leading scientific schools, 2003 . On History of formation and scientific results of the school during 40 years

Еще в разделе: (Показать все результаты (>288) - higeom.math.msu.su/ )

• C*-algebras: Talks
• Toric Topology (English)
• Index of /~asmish/Lichnaja-2010/Version2010-11-20/UchProcess-2009

All PostScript files are compressed by gzip. ... Carrier transport and non-equilibrium phenomena in doped PbTe and related materials. - physica status solidi (a), 1993, 137 , 9-55 ( PostScript file ) ( PDF file ). ... Physics Reports, 1995, 257 , 85-131 ( PostScript file ) ( PDF file ). ... Phys., 1999, 86 , No 6, 3241-3246 ( PostScript file ) ( PDF file ). ... 1999, 14 , No 9, 852-856 ( PostScript file ) ( PDF file ). ... Вестник МГУ, Сер. физ., 2000, в.1, 39-43 ( PostScript file ) ( PDF file ). ...

Еще в разделе: (Показать все результаты (>16) - lizard.phys.msu.su/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>3) - dionis.sai.msu.ru/ )

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>8) - ecoinformatica.srcc.msu.ru/ )

... II « » Symposium "Big History and Global Evolution" « : , , , » ( ) "Big History and Global Evolution" Scientific School for Youth "Historical globalistics: historical evolution, the present and forecast scenarios of global networks, global processes and institutions of global scale, and role of Russia and BRICS" (supported by RSCF) : .. ... 21 » International Scientific Symposium on Sustainable Development "Global Development: local conflict and challenges during 21st century : .. ...

Еще в разделе: (Показать все результаты (>194) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/03/Information-Sheet.pdf

... Publications . Journals . ... Ivanov A. P. , Erdakova N. N. On a mechanical lens . ... Abstract pdf (548.99 Kb) . In this paper, we consider the dynamics of a heavy homogeneous ball moving under the influence of dry friction on a fixed horizontal plane. ... pdf (548.99 Kb) Journal Info . ... http://mipt.ru/science/trudy/ . ... Ivanov A. P. , Shuvalov N. D. , Ivanova T. B. On detachment conditions of a top on an absolutely rough support . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>108) - ics.org.ru/ )

... Process of Forming a Company . ... Инновационная . структура МГУ . ... деятельности . ... Finance for Start-Up . ... Spin-off Company Development at the University of Alberta . ... Spin-off Company Development - Program Guidelines . ... However, these questions may help you determine if the time is right or wrong to proceed with a start-up company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>20) - innovation.msu.ru/ )

• Process of Forming a Company - Discussion Question

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>3) - adept.srcc.msu.ru/ )

• Данные на картах в Интернет
• АДЕПТ инструментальный программный комплекс