Disjoining pressure of an electrolyte film confined between semipermeable membranes Salim R. Maduar and Olga I. Vinogradova Citation: The Journal of Chemical Physics 141, 074902 (2014); doi: 10.1063/1.4892758 View online: http://dx.doi.org/10.1063/1.4892758 View Table of Contents: http://scitation.aip.org/content/aip/journal/jcp/141/7?ver=pdfcov Published by the AIP Publishing Articles you may be interested in Order of wetting transitions in electrolyte solutions J. Chem. ... Chem.- ... Phys. Commun. ...
... In this article, the light propagation in a diffuser with optically soft inclusions is described with the help of the FokkerPlanck equation, i.e., a transfer equation with a diffusion term in the space of radiation-propagation directions. The coefficient of angle diffusion is calculated using the Mie theory. The equation is solved numerically using the stochastic analog method, and the space and angle distribution of the radiation that passed through the diffuser is calculated. ...
[
Текст
]
Ссылки http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-11-JMathSci-Diffuser.pdf -- 359.0 Кб -- 10.02.2011 Похожие документы
Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...
Lomonosov Moscow State University . ... About Us . ... Further Education Programs . ... General Information . ... The Department of Linguistics and Information Technologies . ... The Department of Linguistics and Information Technologies was founded in 2008. ... The latest publication (?21, June 2012, 'Information Technology in Linguistics') was about the Fifth International Scientific and Methodological Conference 'ICT in Linguistics, Foreign Language Teaching and Intercultural Communication'. ...
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...
... N.M. Emanuel Institute of Biochemical Physics, Russian Academy of Sciences . A.N. Bach Institute of Biochemistry, Russian Academy of Sciences . Advanced Biomedical Computing Center , National Cancer Institute at Frederick, MD, USA . Department of Chemistry, University of Southern California , Los Angeles, CA, USA . Department of Biomolecular Mechanisms, Max-Planck Institute for Medical Research, Heidelberg, Germany . ... Joint Supercomputer Center of the Russian Academy of Sciences . ...
... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...
Theoretical problems of electrical double layer structure on ideally polarizable electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistep electrochemical processes limited by mass transfer, electron transfer and chemical reaction. Special attention is paid to computer simulation of specific adsorption and coadsorption of ions and neutral organic molecules on the electrode surfaces. ...
arxiv:0807.5013 Высокоточная геометрия двухполюсного пульсара (High-precision geometry of a double-pole pulsar) . Authors: M. Kramer, S. Johnston . ... Authors: Rene P. Breton et al. arxiv:0807.2522 Guide star каталог второго поколения: описание и параметры (The Second-generation Guide Star Catalogue: Description and Properties) . ... Authors: M.J. Keith et al. arxiv:0807.0660 SN2007ax : Предельно слабая сверхновая типа Ia (SN2007ax : An Extremely Faint Type Ia Supernova) . ...
... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
DAYS on DIFFRACTION' 2011 77 Analytical solutions for diffraction problem of nonlinear acoustic wave b eam in the stratified atmosphere Vladimir A. Gusev, Ruslan A. Zhostkow Department of Acoustics, Physical Faculty, Lomonosov's Moscow State University, Russia; e-mail: vgusev@bk.ru The nonlinear wave equation and mo dified KhokhlovZab olotskaya typ e equation for high intensive acoustics wave b eams propagating in stratified atmosphere with inhomogeneous of sound sp eed is set up. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gusev_files/diff2011.pdf -- 68.4 Кб -- 07.11.2012
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gusev_files/diff2011.pdf -- 68.4 Кб -- 07.11.2012 Похожие документы
яЛП . id #428 . The Journal of Visualization and Computer Animation [not defined] . Common information . Periodicy: . [no information] . Impact-Factor: . [no information] . ISSN: . 1099-1778 . In print: . since 1997-01-01 till 2003-12-31 . Language: . en . Price: . single article - $1 . Classifier: . [no at all] . Comment: . From 2004: Computer Animations and Virtual Worlds . Published by . (4) . Wiley Interscience - roboUpdate . No homepage defined . No open resources defined . Close . Complain . Edit
Кафедра высокопроизводительных вычислений МГУ . Главная . ... Главной задачей кафедры является организация и осуществление на высоком уровне учебно-воспитательной работы по подготовке специалистов высокой профессиональной квалификации по высокопроизводительным вычислениям на многопроцессорных ЭВМ из числа студентов 2-5 курсов механико-математического факультета , физического факультета , факультета вычислительной математики и кибернетики, химического факультета и других факультетов ...
... A direct current with a surface density of jmax ~ 103 A/cm2 violates the symmetry of the electron distribution function and induces the optical second harmonic with an intensity corresponding to the dipole quadratic susceptibility (2)d( jmax) ~ 3 в 1015 m/V. PACS numbers: 7.57.Lm, 76.60.-k DOI: 10.1134/S0021364009020027 The surface nonlinear optics of centrosymmetric media is a rapidly developing line in diagnostic nonlinear optics. ...
[
Текст
]
Ссылки http://nanolab.phys.msu.ru/sites/default/files/jetplett89_58_2009.pdf -- 283.1 Кб -- 16.05.2013 Похожие документы
... Generation of superoxide by the mitochondrial Complex I. Authors: . ... Superoxide production by inside-out coupled bovine heart submitochondrial particles, respiring with succinate or NADH, was measured. ... Both NAD+ and acetyl-NAD+ inhibited the succinate-supported reaction with apparent Ki's close to their Km's in the Complex I-catalyzed succinate-dependent energy-linked NAD+ reduction (reverse electron transfer) and NADH:acetyl-NAD+ transhydrogenase reaction, respectively. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... L Сd , Pol a nd ABOUT EFFECTIVE MODES METHOD FOR DESCRIPTION OF INTERNAL DYNAMICS OF WEAKLY BOUND CLUSTERS Elena Belega, Evgeny Cheremukhin 1 , Dmitry Trubnikov Abstract: New approach to describe the internal dynamics of weakly bound clusters is presented. ... It is found that the number of active collective modes depends on the initial cluster excitation and that the internal energy is partitioned nonuniformly among the modes. ... Collective motion of oxygen atoms performs mostly in plane. ...
[
Текст
]
Ссылки http://beams.chem.msu.ru/doc/Dynamical_systems_Theory_and_applications.pdf -- 148.8 Кб -- 12.10.2012 Похожие документы