Firefly Quantum Chemistry Package Download Area Terms of Use . ... The VISITOR is any individual, research group, institution or organization, or agent who downloads any files or archives containing Firefly Quantum Chemistry Package distribution files ( DISTRIBUTION ) from the Firefly Quantum Chemistry Package Download page(s). ... The copyright and other intellectual property rights in the DISTRIBUTION are the property of the Firefly Project Team. ...

Еще в разделе: (Показать все результаты (>47) - classic.chem.msu.su/ )

• Firefly Home Page
• Firefly and PC GAMESS Version History
• PC GAMESS/Firefly DOCUMENTATION - list of supported Linux MPI implementations

... Database: ss 272 sequences; 3,008,365 total letters Searching..................................................done Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome. (76 letters) Score E Sequences producing significant alignments: (bits) Value AE006646 AE006641 |AE006646| Sulfolobus solfataricus P2 section .. ... Length = 7990 Score = 32.2 bits (16), Expect = 0.038 Identities = 19/20 (95%) Strand = Plus / Plus Query: 8 tagctcagttggtagagcgc 27 || ...

Еще в разделе: (Показать все результаты (>1142) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~igogo/Term3/pa_asp_t.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt
• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_Mb.txt

Third Harmonic Generation in Fishnet Metamaterials M. R. Shcherbkov1, J. Reinhold2, A. S. Shorokhov1, A. Chipouline2, C. Helgert2, T. Pertch2, A. A. Fedyanin1 1 Faculty of Physics, Lomonosov Moscow State University, 119991 Moscow, Russia 2 Friedrich-Schiller-UniversitДt Jena, 07743 Jena, Germany shcherbakov@nanolab.phys.msu.ru Abstract: Optical third harmonic generation in gold-based fishnet metamaterials is studied. ...

Еще в разделе: (Показать все результаты (>84) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/nl503029j3.pdf
• Our paper has been published in Journal of Magnetism and Magnetic Materials |
• Elizaveta V. Melik-Gaykazyan | Laboratory of Nanophotonics & Metamaterials

... NASA Main Page . NASA Organizations Index . ... Marshall Space Flight Center . ... Science @ NASA: news . ... Goddard Space Flight Center: Science missions . National Space Science Data Center . data from NASA space flight missions, . ... High Energy Astrophysics Science Research Center (HEASARC) - a source of gamma-ray, X-ray, extreme ultraviolet, other wavebands observations of cosmic (non-solar) sources. ... Kennedy Space Center - Publisher's Photo Corner - Photograph Index . ...

Еще в разделе: (Показать все результаты (>8) - astrometric.sai.msu.ru/ )

• standard of astronomical data, catalogs

Topology section consists of 5 plenary talks (by Alexandr Gaifullin, Mikiya Masuda, Serguei Novikov, Charles Pugh, and Nigel Ray) and 3 special sessions: . ... Talks within Topology Section are scheduled on Wednesday, Thursday, and Saturday afternoons and include 30-min and 20-min invited and 20-min contributed presentations. ... Combinatorial and Toric Topology , room 12-13 . ... Arkadiy Skopenkov (MSU, Moscow). ... Inst., ... Natalya Mozhey (State Technological Univ., ... USA); invited speaker . ...

Еще в разделе: (Показать все результаты (>61) - higeom.math.msu.su/ )

• Geometry and Topology (English)

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>10) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Как работает USB write protected? ... Re: Как работает USB write protected? [ re: Una_flor ] . ... Re: Как работает USB write protected? [ re: mr_tron ] . ... Теперь все работает...

Еще в разделе: (Показать все результаты (>2955) - www.fds-net.ru/ )

• [TeX] как не включить заголовок в оглавление? - Public forum of MSU united
• Помогите с видео на Мандриве 2008.1 - Public forum of MSU united student
• Пока "НЕдемократичная" Россия митингует (про дерьмократию запада) - Public

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Как работает USB write protected? ... Re: Как работает USB write protected? [ re: Una_flor ] . ... Re: Как работает USB write protected? [ re: mr_tron ] . ... Теперь все работает...

Еще в разделе: (Показать все результаты (>1781) - www.snto-msu.net/ )

• проблема с видеокартой SUSE 10.3 - Public forum of MSU united student networks
• [TeX] как не включить заголовок в оглавление? - Public forum of MSU united
• Детализация рейтинга: Outsider - Public forum of MSU united student networks

... Unlike the previous digital-only Messages, Arecibo-1974 and Evpatoria-1999, the TAM has complex, three-section structure with different forms of information. Section 1 represents coherent sounding radio signal with slow Doppler wavelength tuning to imitate transmission from Sun's center. ... Section 2 is an analog information and represents musical melodies, performed on the Theremin. ... There were seven musical compositions in the 1st Theremin Concert for Aliens. ...

Еще в разделе: (Показать все результаты (>164) - lnfm1.sai.msu.ru/ )

• Russian SETI
• Michael Kuznetsov HOME PAGE
• IDL programs

МОДЕЛИРОВАНИЕ ВЗАИМОДЕЙСТВИЯ МАГНИТНОГО ПОЛЯ С ОБЪЕМНЫМИ ВЯЗАНЫМИ СТРУКТУРАМИ . ... Представлен механизм взаимодействия магнитного поля с жидкостью. В рамках концепции солитонной модели жидкости предлагается объяснение эффекта памяти в системах с водородными связями в магнитном поле. MODELING OF INTERACTION MAGNETIC FIELD WITH BULK KNITTED STRUCTURES . ... A mechanism of interaction magnetic field with liquid is pre-sented. ... Suppose the structure of such systems to be a bound band. ...

Еще в разделе: (Показать все результаты (>18) - www.library.biophys.msu.ru/ )

... ucar.netcdf.AbstractNetcdf . ... public abstract class AbstractNetcdf . ... Create an empty instance to be populated with instances of some subclass of Variable. protected . ... Returns the set of attributes associated with this, also know as the "global" attributes. ... Returns the set of dimensions associated with this, the union of those used by each of the variables. protected void . ... Returns the set of dimensions associated with this, the union of those used by each of the variables. ...

Еще в разделе: (Показать все результаты (>28) - angel.cs.msu.su/ )

• : Class ConcreteIndexMap
• DataTableModel
• : Class ConcreteIndexMap.ZZMap

1st announcement . INTERNATIONAL SYMPOSIUM ON SPIN WAVES . Saint-Petersburg, May 21 - 24, 2002 . 26th International Symposium on Spin Waves will be held in Saint Petersburg on May 21 -24, 2002 by the Council on Condensed-Matter Physics (Section on Magnetism), Russian Academy of Sciences and A.F. Ioffe Physico-Technical Institute. ... Scope of the Symposium . ... Magnetic excitations in low-dimensional substances . ... Interactions of spin waves with elastic waves and other excitations . ...

Еще в разделе: (Показать все результаты (>40) - genphys.phys.msu.su/ )

• Публикации

... Marina V. Rybakova Ph.D., Professor, School of Public Administration, Lomonosov Moscow State University, Moscow, Russian Federation. ... The author considers the category of responsibility as a component of social environmental practices, in particular the new social practices of eco-tourism in management of protected areas. ... In recent years there has been a major transformation of the federal concept of protected areas. ... Social practices, eco-responsible practices, eco-tourism, protected...

Еще в разделе: (Показать все результаты (>41) - ee-journal.spa.msu.ru/ )

Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... Acta Anaesthesiologica Scandinavica . ... African Journal of Ecology . ... American Art . American Business Law Journal . American Journal of Agricultural Economics . American Journal of Education . American Journal of Epidemiology . American Journal of Political Science . ... Australian & New Zealand Journal of Statistics . ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>4) - wwwlib.phys.msu.ru/ )

Biopolymers, as proteins and DNA-molecules may be interpreted from a theoretical point of view as macromolecules with quenched random disorder along the chain. ... Furthermore, the thermodynamic behaviour of compositionally randomized polymer chains is mainly controlled by the monomer-monomer interaction. ... Finally, we analyze of the thermodynamic properties of random cross-linked polymer networks made of phantom chains with compositional disorder. ...

Еще в разделе: (Показать все результаты (>190) - polly.phys.msu.ru/ )

• Publication list, Olga Shamardina
• HIGH-TEMPERATURE SUPERCONDUCTORS

... file but would like it to be automatically updated # again, run the following command: # sudo dpkg-reconfigure -phigh xserver-xorg Section Files EndSection Section InputDevice Identifier Generic Keyboard Driver kbd Option CoreKeyboard Option XkbRules xorg Option XkbModel pc105 Option XkbLayout us ...

Еще в разделе: (Показать все результаты (>13) - observ.pereplet.ru/ )

... Elsevier Science Ltd[ All rights reserved PII] S 0 2 5 3 п 5 7 1 5 8 7 # 9 9 0 0 0 п 3 3 G[C[ Reid:Journal of Atmospheric and Solar !Terrestrial Physics 50 0888# 2п03 of solar variability that have a direct impact on our immediate environment at the surface of the planet[ Three major categories of solar variability are involved] 0# variations of the spectral irradiance \ especially in the near and middle ultraviolet\ leading to ...

Еще в разделе: (Показать все результаты (>145) - www.kosmofizika.ru/ )

• http://www.kosmofizika.ru/model/obrazec.doc
• http://www.kosmofizika.ru/pdf1/abel_02b.pdf
• http://www.kosmofizika.ru/owz/pudovkin/pudovkin-1.pdf

... mini-EUSO (UV atmosphere) . News . UHECR news . TLE news . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . JEM-EUSO Extreme Universe Space Observatory on the Japanese Experiment Module (JEM) of the International Space Station . ... in Russia by the Russian Space Agency (ROSCOSMOS) under the name UV atmosphere, included in the Long Term Program for Scientific Experiments and Applied Research planned for the Russian segment on ISS (PI B.A. Khrenov). ...

Еще в разделе: (Показать все результаты (>43) - uhecr.sinp.msu.ru/ )

• Publications UHECR
• UHECR news
• Новости КЛПВЭ

... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...

100. Aleksei Zheltikov