... The frequency and time resolution connected by the (a) Kotelnikov-Shannon theorem (b) Heisenberg uncertainty principle (c) probability density (d) Euler equation 5. The window (Gabor) transform differs from wavelet-transform because (a) the first one doesn't allow to detect the changes of spectrum in time (b) the first one doesn't allow to reconstruct the function from it's decomposition (c) wavelet-transform is continuous (d) the resolution of wavelet-transform is adapted to the frequency 6. ...

Еще в разделе: (Показать все результаты (>34) - lnfm1.sai.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Alexander V. Tikhonravov, Tatiana V. Amotchkina, Michael K. Trubetskov, Robert J. Francis, Vesna Janicki, Jordi Sancho-Parramon, Hrvoje Zorc, and Vladimir Pervak, "Optical characterization and reverse engineering based on multiangle spectroscopy," Appl. ... 51, 245-254 (2012) . We perform characterization of thin films and reverse engineering of multilayer coatings on the basis of multiangle spectral photometric data provided by a new advanced spectrophotometer accessory. ...

Еще в разделе: (Показать все результаты (>5) - srcc.msu.ru/ )

• Veber A.A., Romanov A.N., Usovich O.V., Fattakhova Z.T., Haula E.V., Korchak
• Tatiana V. Amotchkina, Michael K. Trubetskov, Alexander V. Tikhonravov, Vesna

LETTERS TO THE EDITOR BASIC DEUTERIUM EXCHANGE IN THE INDOLIZINE SERIES S. I. Bobrovskii, E. V. Babaev, and Yu. G. Bundel' UDC 547.759'828.110.2 Using 2-methyl-6-nitroindolizine as a strated selective basic deuterium exchange for 5 h in a solution of 4 mole/liter MeONa tensity for the lowest field signal for 5-H the spectrum remained unchanged. model indolizine we have for the first time demonat position 5o Thus a sample of I was refluxed in MeOD. ... G. Bundel', Khim. ... 2, 203 (1987). ...

Еще в разделе: (Показать все результаты (>32) - www.chem.msu.ru/ )

... Импорт данных (меню File / Open Image ) в бинарном или ASCII формате с заголовком или без, включая форматы Band Interleaved by Line (BIL), Band Sequential (BSQ), or Band Interleaved by Sample/Pixel (BIS или BIP). ... Вывод многозональных снимков на экран (меню Processo r / Display Image ), в виде черно-белых и цветных изображений в различных палитрах; вывод результатов обработки также в черно-белом и цветном вариантах, с возможностью управления цветовым представлением каждого изображения. ...

Еще в разделе: (Показать все результаты (>60) - www.geogr.msu.ru/ )

• Возможности MultiSpec
• CONTENTS ?3 - 2010

. RFBR - Royal Soc project 2013-2014 in pictures . Cameron is sealing the copper tube with samples . Lewis Downie is supervised by Dr Ardashnikova . Cameron Black, Dr Ardashnikova and Lewis Downie with flame burner and copper tube in the room 450 . Back

Еще в разделе: (Показать все результаты (>6) - www.inorg.chem.msu.ru/ )

Franco Peracchi IV and GMM under weak instruments Spring 2011 Course outline 1. The instrumental variables (IV) method · · · · · · · · · · · · · · · · · · · · · · · · · · · · Inconsistency of OLS The simple IV estimator The class of IV estimators Sampling properties Estimates of statistical precision Hypothesis testing 2SLS Motivating examples Definitions and basic models The bias of 2SLS Standard asymptotic approximations Alternative asymptotic approximations Detecting weak ...

Еще в разделе: (Показать все результаты (>8) - www.mse-msu.ru/ )

... SDPfox - the software package for the prediction of functional specificity groups and amino acid residues that determine the specificity using MPA. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...

Еще в разделе: (Показать все результаты (>11) - bioinf.fbb.msu.ru/ )

Light ­induced dispersed vibrational IR-emission: a new technique to study molecular states Terpugov E.L, Degtyareva O.V. Institute of Cell Biophysics Russian Academy of Sciences, Pushchino, Moscow region, Institutskay st.3, 142290 Russia; Phone: +(4967)739393; Fax:+(4967) 330509, Olga_degt@mail.ru Infrared Emission Spectroscopy, technique rarely applied in the past. ... 2] Akhmanov A. and Koroteev N.I., Methods of Nonlinear Optics and Light Scattering Spectroscopy // Moscow, Nauka, (1981). 586 pages. ...

Еще в разделе: (Показать все результаты (>13) - www.msm.biophys.msu.ru/ )

• MSM 2007

... Формирование современных парадигм исследования поведения. Основные направления исследований поведения в конце 19-го - первой половине 20 века. Основные современные направления изучения поведения. ... Классическая этология. ... Представление о коммуникации у животных с позиций классической этологии. Представление об эволюции поведения с позиций классической этологии. ... Бихевиоризм и теории обучения. ... Наблюдение за 'фокальным' животным (Focal Animal sampling). ... М.: Мир, 1975 . ...

Еще в разделе: (Показать все результаты (>33) - vertebrata.bio.msu.ru/ )

• Student Reports at International Conferences
• Выступления студентов и аспирантов на конференциях

LabVIEW 2011 1 .. ... DAQ- 1. ... Functions -. Numeric, , Functions >> Programming (. 6). ( , e .) ... LabVIEW , , PCI, , USB. DAQ- ( Data AcQuisition = ). ... USB 6009 N = 14 , 2 14 = 16384 . ... USB 6009 DAQ ; ; ; USB . ... National instruments Data Acquisition (DAQ) USB terminal / . ... DAQ Assistant. DAQ Assistant ( Functions >> Express >> Input), -, . ... DAQ- USB 6009, , 1. ... data DAQ Assistant - , , ­ . ... DAQ Assistant Std Deviation&Variance , , data, , Std Deviation&Variance. ...

Еще в разделе: (Показать все результаты (>10) - genphys.phys.msu.su/ )

Oxygen Analyzers Electrochemical oxygen analyzers are based on electrochemical reduction of O2 at a negatively polarized electrode. This principle lies in the bases of the Clark-type oxygen-sensitive electrode. [pic] pO2 (CLARK) ELECTRODE This electrode is known as "Clark Type" after their inventor, Dr. Leland Clark. The Clark electrode consists of an anode and cathode in contact with an electrolyte solution. ... The Clark (pO2) electrode measures oxygen tension amperometrically. ...

Еще в разделе: (Показать все результаты (>48) - www.enzyme.chem.msu.ru/ )

Lectures on Nanomagnetism Prof. M. Farle www.unidue.de/agfarle University DuisburgEssen ( Lectures will be given in English with (partial) Russian translation upon request) th Lecture Hall: library of faculty of physics, 5 floor Monday, 24.03.2014 Duration 30 min 15:15 15:45 30 min 15:45 16:15 30 min 16:15 16:45 break 45 min 17:00 ­ 17:45 45 min 17:45 ­ 18:30 Tuesday, 25.03.2014 45 min 15:15 ­ 16:00 45 min 16:00 ­ 16:45 break 45 ...

Еще в разделе: (Показать все результаты (>26) - phys.msu.ru/ )

• Сотрудники физического факультета МГУ
• Title

... These websites can only be found over the Tor anonymity network .Eric Eoin Marques, who owned and operated the Freedom Hosting service inside the Tor network , is currently beingheld without bail in Ireland.The service isbelieved to be one of the largest operators within Tor , providing popular privacy tools such as TorMail.On Saturday, Marques had a preliminary US extradition trial, where he faced charges ... cheap michael kors uk . michael kors outlet uk . ...

Еще в разделе: (Показать все результаты (>4) - elana.sinp.msu.ru/ )

... This technology presumes that blood sampling is performed by patient himself, the sample is spotted on a dry, as a rule, porous surface (filter paper, cellulose acetate membrane, etc.), and the posterior transportation to a laboratory, for example, by post in a standard or a special envelope. ... Under the dried blood spot technology using, the problem of the sample spotted volume determination remains one of the main practical questions. ... The problem is to find a function f (y1 , y2 , . ...

Еще в разделе: (Показать все результаты (>38) - higeom.math.msu.su/ )

... ПРОВЕДЕНИЕ ЭЛЕМЕНТНОГО АНАЛИЗА ПИТЬЕВОЙ ВОДЫ . ... проведение анализа элементного состава питьевой воды с целью подготовки . ... работы по отбору проб воды, а собственно анализ химического состава этих . ... анализа элементного состава были выбраны следующие пробы воды: . ... Из полученных результатов анализа проб питьевой воды следует, что . ... значительное (более чем на порядок) превышение норм ПДК по алюминию . ... ко 2 классу опасности химических элементов, наличие его в питьевой воде, . ...

Еще в разделе: (Показать все результаты (>4) - www.ecocoop.ru/ )

• http://www.ecocoop.ru/monitor/archive1/messages/133.html

... The brain natriuretic peptide (BNP) precursor is the major immunoreactive form of BNP in patients with heart failure. ... BACKGROUND: Peptides derived from brain natriuretic peptide (BNP) precursor (proBNP), BNP, and the N-terminal fragment of proBNP (NT-proBNP) are used as biomarkers of heart failure. ... The mean proBNP:BNP ratio in patient plasma was 6.3, ranging from 1.8 to 10.8. CONCLUSIONS: ProBNP is the major BNP-immunoreactive form in human blood. ...

Еще в разделе: (Показать все результаты (>12) - biochem.bio.msu.ru/ )

• Low Concentrations of Hydrogen Peroxide Activate the Antioxidant Defense System
• Measurement of B-type natriuretic peptide by two assays utilizing antibodies
• Development of a candidate secondary reference procedure (immunoassay based

... Полная версия: программа для "адаптации" обычной песенки на танцевальные есть? Грация-МГУ::Форум > Мультимедия > Аудио . Oneill . Dec 1 2009, 00:24 . Интересно, как это делать - обыная песенка, сделать ее танцевально-приемлевой? ... Цитата(Oneill @ Dec 1 2009, 21:54) . ...

Еще в разделе: (Показать все результаты (>2) - grace.msu.ru/ )

. Помощь - Поиск - Пользователи - Календарь . Полная версия этой страницы: Прога для ОММ . Студенческий форум Физфака МГУ > Физфак и учеба > Экзамены, зачеты, лекции, семинары, физпраки . ivandasch . 1.6.2005, 23:54 . на ftp://ggg.podzone.org/ggg/omm_samples лежит пример описания в djvu и код проги для граничных условий Дирихле и Неймана ( Dirichlet и Neumann) . Для просмотра полной версии этой страницы, пожалуйста, пройдите по ссылке . Русская версия IP.Board 2001-2016 IPS, Inc.

Еще в разделе: (Показать все результаты (>25) - wasp.phys.msu.ru/ )