... Phys. Solid State 30 , N 2, 303 (1988). ... An X-ray diffraction investigation was made of the distortions of the fcc lattice in a series of solid solutions of IV-VI semiconductors in which low-temperature phase transitions were expected. ... Keywords: semiconductor solid solutions, lead tin telluride, lead telluride sulfide, lead germanium telluride, lead germanium telluride selenide, indium, sulfur, Curie temperature . ...

Еще в разделе: (Показать все результаты (>64) - scon155.phys.msu.su/ )

... 2, 1998 UNEXPECTED RECYCLIZATION OF PYRIDINIUM SALTS TO GIVE OXAZOLES E. V. Babaev and A. A. Tsisevich N-(Acylalkyl)-2-halopyridinium salts (I) are commonly used in the synthesis of azolopyridines with a bridging nitrogen atom. In particular, the formation of imidazo[l,2-a]pyridines and their N-alkyi- and N-aryl derivatives in the reaction of salts I with ammonia and primary amines [1, 2] or aromatic amines [1] is well known. ... Reactions of salts I with secondary amines have not been reported. ...

Еще в разделе: (Показать все результаты (>176) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/117e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/040e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/017e.pdf

... Physical Chemistry Division , . Department of Chemistry , . M.V.Lomonosov Moscow State University , . Moscow 119991 Russian Federation . ... Undergraduate student, Special Group for Physical Chemistry, Chemistry Department, Moscow State University. ... Physical Chemistry . ... 2005 - International Mendeleev's Chemistry Olympiad, Tajikistan - Silver Medal . 2006 - International Mendeleev's Chemistry Olympiad, Armenia - Gold Medal . ...

Еще в разделе: (Показать все результаты (>4) - lcc.chem.msu.ru/ )

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>37) - ideas.msu.ru/ )

• http://www.msu.ru/int/newpr/7ram/7ram_napr.pdf
• http://ideas.msu.ru/docs/CSA_guide_2008.pdf

... Journal of Epidemiology and Community Health [J Epidem Commun Health] . Common information . ... since 1975-01-01 till today . ... subscription - $1100,single article - $1 . ... FREE back issues 12 monthes after publication! Needed free registration! ... http://jech.bmj.com/ . ... today . ... http://jech.bmj.com/contents-by-date.... 1998-03-01 . ... http://jech.bmj.com/contents-by-date.. ...

Еще в разделе: (Показать все результаты (>483) - journals.genebee.msu.ru/ )

... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>17) - pk.math.msu.ru/ )

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>192) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.8 Services Help
• GeneBee BLAST 2.2.22+ Services Help
• GeneBee Services

. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>18) - www.dubinushka.ru/ )

All your comments please send to Yagola Anatoly ( yagola@prof.msu.ru ) or to web-deseigners of the site ( ill-posed@mail.ru , nataschka_@mail.ru ).

Еще в разделе: (Показать все результаты (>83) - foroff.phys.msu.ru/ )

... Comment . ... few seconds ago reply to comment . Write a comment.. ... Good work, originayla idea! . ... First time I've heard that. few seconds ago reply to comment . ... few seconds ago . ... We must be good! . ...

Еще в разделе: (Показать все результаты (>437) - chronos.msu.ru/ )

• A.P.Levich. What we expect from studying time
• Электронные библиотеки мира
• On the Way to Understanding the Time Phenomenon: the Constructions of Time in

Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . You may download the latest source code distribution and install the period search service at your own web server. ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...

Еще в разделе: (Показать все результаты (>4) - unesco.fgp.msu.ru/ )

• News from the UNESCO Chair on Global Problems Кафедра ЮНЕСКО по изучению

... Выпускники . Выпускники ВМиК . ... Женский клуб . ... Издательство МГУ . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... Senior IFP Fall 2005 . The Center on Philanthropy and Civil Society's Senior International Fellows Program provides an opportunity for the professional development of Third-Sector practitioners from outside the United States who are decision makers in their professions. The program is designed to help build Third-Sector capacity in the Fellows' home countries. ...

Еще в разделе: (Показать все результаты (>397) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Канада инвестирует 1 млрд $ в систему контроля
• Клуб выпускников МГУ: International Fellows Program
• Клуб выпускников МГУ: "Внутренние часы" тела можно повернуть вспять, доказали

Подписка на рассылку обзоров astro-ph на Subscribe.Ru . ... Новый рентгеновский пульсар в остатке сверхновой . ... Верное и неверное в данных Hipparcos . ... Из раздела physics . ... Обзоры препринтов astro-ph . ... Comments: 8 pages, 5 figures; proceedings of a workshop on Stellar End Product, to appear in MmSAI (expected to be 2006, volume 77, number 1) . ... Comments: Accepted for publication by A , 18 pages, 23 figures . ... Comments: 31 pages, 13 figures, review paper for Astrophysics Update 2 . ...

Еще в разделе: (Показать все результаты (>421) - astro.uni-altai.ru/ )

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>164) - www.pereplet.ru/ )

• "Урания" - Портал "Русский переплет" Soros Education Journal

... Сайт МГУ . ... Дистанционные олимпиады Факультета иностранных языков и регионоведения Интервью заместителя декана по информационно-образовательным технологиям Назаренко Аллы Леонидовны. фото дня Фоторепортаж с "Дня первокурсника" . ... Центр дистанционного образования МГУ имени М.В.Ломоносова предлагает школьным учителям обучение по следующим программам повышения квалификации: . ... Добавлена информация о дистанционной программе MBA Экономического факультета МГУ . ... и непрерывного образования МГУ,...

98. http://seac47-2.phys.msu.ru/proc/E18_Poplavsky.pdf

99. http://acat02.sinp.msu.ru/plenary.html

100. Category: Новости