... The REACTOR-P parallel program system is described. ... A new data parallel language named C-DVM for implementing portable codes on multiprocessor computers has been developed. ... Development of Methods and Tools for Creating Portable and Efficient Parallel Programs . ... The system is based on the new language model and new methodology, it is aimed at simplifying development, debugging, testing, performance evaluation and maintenance of portable and efficient parallel programs. ...

Еще в разделе: (Показать все результаты (>162) - sp.cs.msu.ru/ )

• Lib-DVM. Interface description
• Prefictor of DVM-program performance. User's guide
• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry

О кафедре . Сотрудники . ... Публикуем материалы сотрудников кафедры . ... Кафедра математических и компьютерных методов анализа создана приказом ректора МГУ в 2008 году. ... Сотрудники кафедры проводят научные исследования в следующих областях: аналитическая теория чисел, математический анализ, теоретико-числовые методы в криптографии, сложность вычислений, компьютерная криптография, компьютерная геофизика. ... 2016, Кафедра математических и компьютерных методов анализа. ...

Еще в разделе: (Показать все результаты (>2) - mkma.math.msu.su/ )

Courses Overview Human resources management (English) The course is aimed at creating an overall understanding of human resources (HR) management system. ... Key topics: main theories and concepts of human resources management, personnel planning, HR policies, personnel selection and hiring, personnel development, career management. ... Insurance and risks The course presents an overview of economic, legal, and administrative bases of insurance. ... Key topics: depending on a company profile. ...

Еще в разделе: (Показать все результаты (>69) - www.mgubs.ru/ )

• http://www.mgubs.ru/images/Image/Courses%20overview.pdf

... Articles . ... S.V. Balakhonov, B.R. Churagulov . ... Yu.V. Kolen'ko, A.A. Burukhin, B.R. Churagulov and N.N. Oleinikov . ... Burukhin A.A., Oleynikov N.N., Churagulov B.R., Demazeau G., Solozhenko V.L., Kolen'ko Yu.V. "Synthesis of nanocrystalline zirconia powders from hydrothermal and supercritical solutions" . ... Burukhin A.A., Churagulov B.R., Oleynikov N.N., Kolen'ko Yu.V. "Synthesis of Nanostructured Iron Oxide(III) Powders by Rapid Expansion of Supercritical Fluid Solutions" . ...

Еще в разделе: (Показать все результаты (>25) - www.inorg.chem.msu.ru/ )

• Группа гидротермального синтеза :: Публикации

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>59) - monkey.belozersky.msu.ru/ )

• About authors ot this complex
• Homeodomain numeration assumed

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>467) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Список востребованных профессий Австралии
• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... 3 ­ Sternberg State Astronomical Institute, Moscow, :jeanna@sai.msu.ru The graphic method of the analysis of an arrangement of linear structural elements on geographical and geological maps of continents (A.V.Dolitsky, [1]) has allowed to find out global stress fields of the past and among them one which directions (the main normal and maximal tangents) describe more than 80 % of all linear elements of a relief. ... The found poles share program way on density of an arrangement on 3-4 groups. ...

Еще в разделе: (Показать все результаты (>74) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Chik/Publications/Aitken/MS015.pdf
• Yurii Naumovich Lipsky

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>149) - uneex.mithril.cs.msu.su/ )

... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>16) - lhe.sinp.msu.ru/ )

• MSU.ru Atlas computing

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>7) - asa.guru.ru/ )

... It is more convenient to study the process of perfect flora revealing on the objects with clear natural borders, such as islands and lakes. ... We also compared our floristic lists for the two islands of the Chupa bay with analogous lists, got in the beginning of August 2001 (White sea expeditions…, 2001; Abramova et al., 2003) to reveal the changes in islands flora during these five years. ... Different species were usually overlooked on the close islands with similar flora. ... Chupa bay islands ....

Еще в разделе: (Показать все результаты (>178) - herba.msu.ru/ )

• Systema Naturae
• Insect catching and carnivorous plants
• Publications about flora

... NADH/NAD+ interaction with NADH: ubiquinone oxidoreductase (complex I). ... 2008 Jul-Aug;1777(7-8):729-34. doi: 10.1016/j.bbabio.2008.04.014. Epub 2008 Apr 18. ... The quantitative data on the binding affinity of NADH, NAD(+), and their analogues for complex I as emerged from the steady-state kinetics data and from more direct studies under equilibrium conditions are summarized and discussed. ...

Еще в разделе: (Показать все результаты (>62) - biochem.bio.msu.ru/ )

• Reversibility of nucleoside diphosphate kinase solubilization from the surface
• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase
• Interaction of Hsp27 with native phosphorylase kinase under crowding...

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>145) - www.fadr.msu.ru/ )

• Untitled
• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

This document covers stopping and restarting Apache on Unix and Cygwin only. ... Then the parent itself exits. ... It re-reads its configuration files, and re-opens any log files. ... Note: If your configuration file has errors in it when you issue a restart then your parent will not restart, it will exit with an error. ... The USR1 signal causes the parent process to advise the children to exit after their current request (or to exit immediately if they're not serving anything). ...

Еще в разделе: (Показать все результаты (>80) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules
• Definitions of terms used to describe Apache directives
• Apache modules

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

Еще в разделе: (Показать все результаты (>9) - www.sciencepark.ru/ )

Lomonosov Moscow State University was established in 1755 . ... MSU Web Sites . ... Faculties . ... Study and Research . ... MSU Online . ... Specialist's degree takes 6 academic years to complete. ... FIRST STEP ? ... COME TO MOSCOW, RUSSIA AND BRING ALL ORIGINAL DOCUMENTS WITH YOU . ... To get a letter of invitation, necessary for receiving a student visa, please send (via mail, fax or e-mail) the following documents to the Department of international studies of the chosen faculty: . ...

Еще в разделе: (Показать все результаты (>135) - www.msu.ru/ )

• Bachelor studies
• Post-graduate studies
• Master studies

Кафедра высокопроизводительных вычислений МГУ . Главная . ... Главной задачей кафедры является организация и осуществление на высоком уровне учебно-воспитательной работы по подготовке специалистов высокой профессиональной квалификации по высокопроизводительным вычислениям на многопроцессорных ЭВМ из числа студентов 2-5 курсов механико-математического факультета , физического факультета , факультета вычислительной математики и кибернетики, химического факультета и других факультетов ...

99. Добро пожаловать! | Кафедра математического моделирования и информатики

100. Студенческий форум Физфака МГУ > Аспирантура в США