... Variations in soil acidity and in biodiversity were analysed in the National Natural Park "Russian North", European Russia. Improving soil quality from podzol, podzolic soil, derno-podzolic soil, brown earth to pararendzina leads to increase in diversity and changes in floristical composition, followed by changing of pine and spruce forest to mixed and birch forests. ... Our study shows that plants notably respond to soil acidification in boreal forest ecosystems. back . ...

Еще в разделе: (Показать все результаты (>36) - eco.soil.msu.ru/ )

• Pine Needle Chemistry near a Large Point SO2 Source in Northern Fennoscandia
• Koptsik G.N., et al. Soils of the National Park "Russian North".
• Koptsik G.N., et al. Response of pine forests to long-term air pollution at the

... О хоре . История хора . ... Выступление Академического хора МГУ в Крокус Сити Холле . ... Епископ Тихон открыл выступление хора МГУ в Вене . Хор МГУ выступил в Венском отделении ООН . Выступление хора на торжественном открытии Международного научного конгресса ?Глобалистика ? 2015? ... Академический хор Московского государственного университета имени М. В. Ломоносова . ... Прослушивания состоятся в течение всего сентябряљв 311 и 316 классах Культурного центра МГУ в 18-30 . ...

Еще в разделе: (Показать все результаты (>2) - choir.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... McCabe D.L. , Trevino L.K. , Butterfield K.D. Dishonesty in academic environments // J. of higher education . Columbus, 2001. Vol. ... США. Ключевые слова: Высшая школа. ... СТАТЬИ . ... Финансирование, публикации, статистические данные о деятельности 20 университетов США в 1981-1998 гг. ... ЗАРУБЕЖНЫЕ УНИВЕРСИТЕТЫ. ДРУГИЕ СТРАНЫ ЕВРОПЫ. ... ЕВРОПА. ... История геофизической обсерватории при Лейпцигском университете, с 1932 г. Ключевые слова: История университетского образования. ...

Еще в разделе: (Показать все результаты (>190) - srcc.msu.ru/ )

• http://srcc.msu.ru/nivc/about/lab/lab1_7/univer_press4/ItemsJ5.htm
• http://srcc.msu.ru/nivc/about/lab/lab1_7/univer_press4/ItemsT15.htm
• Voevodin Vladimir CV

... Russia and France have contributed significantly to scientific and research progress and cultural development of mankind. ... This is the reason for the international academic community to be closely monitoring today the reform, which is taking place in the educational systems of Russia and France, believing that the outcome of these changes will create new opportunities to strengthen the intellectual capacity and adapt to new economic and technological trends for a large number of countries. ...

Еще в разделе: (Показать все результаты (>136) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/173.doc
• http://www.rsr-online.ru/doc/2011_03_29/6.pdf
• http://www.rsr-online.ru/doc/norm/354.doc

... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...

Еще в разделе: (Показать все результаты (>25) - polit.msu.ru/ )

• http://polit.msu.ru/pub/ASP_document/2014/19.00.12.doc
• http://polit.msu.ru/pub/exam/2014/SPP_19.00.12_lit.doc

... The coherent control of relaxation processes in excited states of 4-dimethylaminochalkone fluorescent probe. Results of quantum chemical simulation." ... These results can help to explain the experimental data on the possibility of coherent control of excited state relaxation for a solvated N,N-dimethylaminochalcone molecule. Keywords: quantum chemical simulation, nonadiabatic molecular dynamics, TDDFT, fluorescent probe, coherent control, nonradiative relaxation . ...

Еще в разделе: (Показать все результаты (>425) - num-meth.srcc.msu.ru/ )

• "A software complex for the analysis and visualization of monitoring and
• "Calculation of excited states of the polycation Bi 3+ 5 by the spin-orbit
• "On optimization of computing applications for multiprocessor systems with

Russian page . Office: room A-402 (or C-03), Geological Department, Moscow State University, Vorobievi Gori, Moscow,119899, Russia Office Phone 07(095)-939-18-41, Fax: 07(095)-9328889 Email: pavel@web.ru . My Biographical INFO is not interesting, and you could skip it .. ... Associate Proffessor, Moscow State University, Geological Department, Experimental Petrology & Data Processing. ... Volcanism of the Kurile-Kamchatka Arc is a one of the most interesting petrologic problem. ...

Еще в разделе: (Показать все результаты (>699) - geo.web.ru/ )

• COMAGMAT MODEL
• США_минералы и самоцветы - символы штатов
• Trusov Sergey's homepage The influence of boundary layer effects on the melt

... 210th anniversary of MSN . In 2015, the Society celebrates the 210th anniversary since its foundation. ... MOIP (Moscow Society of Naturalists) is a unique social phenomenon in Russia?s life. ... The Society has celebrated two-hundredth anniversary, so it is quite natural it had a lot of members from different generations. ... The Society?s goal was to study the country in natural and historical perspective, to facilitate science development and uniting scientists having different specialties. ...

Еще в разделе: (Показать все результаты (>9) - www.moip.msu.ru/ )

... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>61) - nano.msu.ru/ )

• Statute on the Methodical Commissions of the MSU Nanotechnology Education and
• Composite Nanomaterials Master?s Program | MSU Nanotechnology Education and
• Composite Nanomaterials Educational Program | MSU Nanotechnology Education and

Dmitry Karpov . Dmitry Karpov was born in Moscow, Russia. ... Dmitry Karpov studied mechanisms of formation of the valence band in the water Raman Scattering (RS) spectrum. In particular, he focused on (1) the effect of the ion hydration type change due to the temperature variation on the valence band shape in the water RSS and (2) the study of the Fermi resonance role in the formation of the valence band in the water RSS by using the RS temperature dependence. ...

Еще в разделе: (Показать все результаты (>42) - rswater.phys.msu.ru/ )