... quantum optics - different types of the light interference, . ... Another branch of my activity covers the problem of biphoton interference (1997-). ... Also we developed the effective interferometric protocols to generate some specific quantum states of light (the Bell states) in the most common case: broad spectrum of the pump (in particular for the femtosecond laser), any type of phase-matching (either type-I or type-II), and arbitrary length of nonlinear crystals. ... QUANTUM TELEPORTER . ...

Еще в разделе: (Показать все результаты (>57) - qi.phys.msu.ru/ )

• PUBLIC

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>23) - srcc.msu.ru/ )

• D.D.Sokoloff, A.F.Lanza, D.L. Moss, S.M.Tarbeeva. Polar branches of stellar
• Moss, D., Sokoloff, D., Lanza, A. F..Polar branches of stellar activity waves:
• Laboratory of Informatics

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... News . About choir . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Bishop Tikhon opened the choir of Moscow State University in Vienna . Choir of Moscow State University spoke at the Vienna branch of the United Nations . ... Posted in: News . Sorry, this entry is only available in Русский . ... Older Entries . ...

Еще в разделе: (Показать все результаты (>11) - new.choir.msu.ru/ )

• Concerts | Academic choir of Moscow State University
• Conductor | Academic choir of Moscow State University
• Contacts | Academic choir of Moscow State University

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Delphi] ActiveX + TListView . ... Re: [Delphi] ActiveX + TListView [ re: drunken ] . ... FListView := TListView.Create(MyForm); . ... Re: [Delphi] ActiveX + TListView [ re: VVp ]...

Еще в разделе: (Показать все результаты (>593) - www.snto-msu.net/ )

• Хоккей ЧМ 2008 - Public forum of MSU united student networks
• [CSS] Как задать стиль по пользовательскому атрибуту - Public forum of MSU
• LGBT в России - Public forum of MSU united student networks

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

Еще в разделе: (Показать все результаты (>3) - www.sciencepark.ru/ )

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>3) - www.edst.msu.ru/ )

. Name . Last modified . Size . Description . Parent Directory . - . 2014 2015/ . 18-Dec-2014 09:26 . - . 2015 2016/ . 09-Feb-2016 14:24 . - . About Lab/ . 20-Apr-2011 14:58 . - . Anketa/ . 14-Apr-2015 09:59 . - . Apache/2.2.3 (CentOS) Server at jaffar.cs.msu.su Port 80

Еще в разделе: (Показать все результаты (>12) - jaffar.cs.msu.su/ )

• Index of /mash/os/2014 2015
• Index of /mash/os/2015 2016
• Index of /mash/os/About Lab

... 2008-06-05 18:33 . ... 2011-04-27 14:10 . ... 2009-01-14 15:41 . ... pdb_new/ . ... 2010-12-28 14:23 . ... Apache/2.4.10 (Debian) Server at mouse.belozersky.msu.ru Port 80 ...

Еще в разделе: (Показать все результаты (>309) - mouse.belozersky.msu.ru/ )

• S : rm_systems
• PLANdbAffy: probe-level annotation database for Affymetrix expression
• Index of /npidb/pdb/pdb_new/scop_contact_type

... 31-Oct-2005 10:41 . ... 10-Oct-2009 09:20 . ... 02-Nov-2006 13:48 . ... l14_lazutin.ppt . 13-Jan-2012 11:25 . ... lazutin.htm . ... 24K . ... 03-Nov-2015 16:43 . ... 13-May-2008 21:35 . ... 1.2M . ...

Еще в разделе: (Показать все результаты (>175) - www.kosmofizika.ru/ )

• Index of /ucheba
• Index of /history
• Index of /irkutsk

. Name . Last modified . Size . Description . Parent Directory . - . 2014 2015/ . 18-Dec-2014 09:26 . - . 2015 2016/ . 09-Feb-2016 14:24 . - . About Lab/ . 20-Apr-2011 14:58 . - . Anketa/ . 14-Apr-2015 09:59 . - . Apache/2.2.3 (CentOS) Server at jaffar.cs.msu.ru Port 80

Еще в разделе: (Показать все результаты (>12) - jaffar.cs.msu.ru/ )

• Index of /mash/os/2014 2015
• Index of /mash/os/2015 2016
• Index of /mash/os/About Lab

... Submit your article . ... Natalia S. Grigorieva Ph.D., professor, School of Public Administration, Lomonosov Moscow State University. E-mail: grigorieva@spa.msu.ru . ... Irina V. Yakovleva Ph.D., senior lecturer, School of Public Administration, Lomonosov Moscow State University. ... This article analyses the phenomenon of childlessness grounded on the sociological research carried out in different countries. ... There are two different approaches to the phenomenon of voluntary childlessness. ...

Еще в разделе: (Показать все результаты (>48) - ee-journal.spa.msu.ru/ )

... Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr. ... Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. <div class="myclass">...</div> . ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna. ...

Еще в разделе: (Показать все результаты (>4) - physcontrol.phys.msu.ru/ )

• List All Categories

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>35) - classic.chem.msu.su/ )

• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2
• PC GAMESS version 7.1 to version 7.1.5 update information

Core information (Nucleus, Levels, Gamma transition, Decays, Data type) . ... any adopted (levels and gammas only) experimental . ... Query parameters: . Select for output . ... Levels (E, JPI, T1/2, etc.) ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . Relative photon intensity . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ...

96. Index of /~basrav/supercomp2010

97. Index of /courses/geo/lib/books/Brown x26; Mussett The Inaccessible Earth/

98. Index of /lk/source