... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Main Discography . Studio Albums . ... CD Singles . ... Joe Satriani . ... The Essential Deep Purple Survival Kit . ... Deep Purple Tribute Albums . ... The Highway Star's Deep Purple Discography seeks to cover all, or at least most, official releases. ... Joe Cath <joecath(at)aol.com> . ... Rasmus Heide <rasmus(at)deep-purple.com> . ... Benny Holmstr?m <benny(at)deep-purple.com> . ... Ed Janx <edjanx(at)deep-purple.com> . ... Stathis Panagiotopoulos <span(at)deep-purple.com> . ... Deep Purple ! ...

Еще в разделе: (Показать все результаты (>20) - shamolin2.imec.msu.ru/ )

e mail: level_s@rambler.ru) , , , , , , , , conflict theory, social order, functionalism, social integration, system integration, Talcott Parsons, Ralf Dahrendorf, John Rex, David Lockwood . ... The theory of the conflict proceeds from belief that society always contains fundamental conflicts of interest and that social order is achieved by balance of power in which the interests of the stronger successfully contain and channel the demands of the weaker. ...

Еще в разделе: (Показать все результаты (>2) - vestnik.socio.msu.ru/ )

... Клуб выпускников / Члены клуба / Результаты поиска . клуб выпускников члены клуба вступить в клуб доска объявлений наши партнеры . Найдено 2636 записей, удовлетворяющих условиям поиска: . ... Loginova (Kalinina) Anna Borisovna . ... Pidpalaya Alexandra Alexandrovna . ... Pykhova Elena Leonidovna . ... Rimashevskaya Marianna Alexandrovna . ... Smoljakova Elena Kirillovna . ... Syrnikova Anna Nikolaevna . ... Volgemut (Pikina) Elena Evgenievna . ... 2636. ...

Еще в разделе: (Показать все результаты (>2) - www.guru.ru/ )

Title Author Key words Theories of social mobility in the history of sociological thought Baturenko S.A. theories of social mobility, social stratification, Karl Marx, Pitirim Sorokin, Reinhard Bendix, Seymour Martin Lipset, David Glass In this article evolution of theories of social mobility in the history of social thought from the classical period of development until the end of the XX century is analyzed. ...

Еще в разделе: (Показать все результаты (>10) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/07.pdf
• English version - Социологический факультет МГУ

... Head of the seminar: Prof. B.V. Somov, . ... The seminar considers the questions related to generation of magnetic fields in astrophysical plasmas, effect of the magnetic reconnection and particle acceleration in strong magnetic fields, the origin and propagation of cosmic rays, the flares and other non-stationary phenomena in the solar atmosphere and solar wind, Sun Earth connections and physical processes in the heliosphere. ... On the Topological Models and Topological Trigger of the Solar Flares...

Еще в разделе: (Показать все результаты (>3) - sun.sai.msu.ru/ )

... The Economics Education and Research Consortium (EERC-Russia) has the opportunity to allocate two Swedish Professorship Awards to promising young CIS nationals who hold PhD degrees in economics from reputable Western universities and are interested in an academic position in Russia or Ukraine. ... EERC welcomes applications from candidates with excellent backgrounds in any field of economics. ... Three confidential letters of recommendation (to be sealed and sent by surface mail to EERC) . ...

Еще в разделе: (Показать все результаты (>40) - www.prof.msu.ru/ )

• Short-Term Travel Grants
• The 7th Annual International Education Fair
• Ahtisaari Recognized as International Peacemaker

... MSU Chamber Orchestra . ... Concerto МГУ . ... music of XVI - XVIII cc. ... Natalia AZARKINA, Alexander KONSTANTINOV, Olga ZHUKOVA (violins) . ... Metro station "Riazanskij prospekt", "Vyhino"; buses 208, 133 . ... Alexander Konstantinov, music director . ... Sarra - Galina ZHUKOVSKAYA (soprano) . ... Olga NAZAIKINSKAYA (soprano) . ... Alexander KONSTANTINOV, Olga ZHUKOVA (violins) . ... Vladimir DROZDOV ( viola da gamba) . ... Olga ZHUKOVA, Alexander KONSTANTINOV . ... Olga NAZAJKINSKAJA soprano . ...

Еще в разделе: (Показать все результаты (>2) - music.genebee.msu.su/ )

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... International . ... Partners . ... International school Russian Media and Journalism-2015 . Faculty of Journalism, Lomonosov Moscow State University annually holds a 5 credit programme for international students called ?Russian media and journalism?. ... To apply for the international school ?Russian media and journalism?, pleaseљ download our application form љand send it toљ Russian.journalism.school@gmail.com . ...

Еще в разделе: (Показать все результаты (>20) - www.journ.msu.ru/ )

• Title :: Department of Journalism, M. V. Lomonosov Moscow State University

Vespertilio 17: 127­128, 2014 ISSN 1213-6123 New records of the bat fly Basilia mongolensis in the mountains of Asia (Diptera) Maria V. o rlova & Alexandr V. Z higalin National Research Tomsk State University, 36, Lenina str., ... In total, 12 specimens were collected from five individuals of the David's Myotis Myotis davidii (Peters, 1869). These findings specify the range of this poorly known bat ectoparasite species in Central Asia and southern Siberia (the northern margin of its distribution). ...

Еще в разделе: (Показать все результаты (>252) - zmmu.msu.ru/ )

• Cladistic analysis of the dormouse genus Graphiurus Smuts, 1832 (Rodentia:

... 4. (lock-in) - , SIN +1,-1 ; , .3. , . ... y(n)=-a1 y(n-1)+b0x(n)+ b1x(n-1) , .3. "" . ... 2 SIN . # include cdef2181.h # include math.h #define MAX_ INT (32767) #define bufset( buf, val, size) \ ( { int _i; for( _i=0; _i size; _i++) buf[ _i] = val; } ) const int amp=10000; const float pi=3.141592654; int n=0, fr_num=0, sig=0, i=0, STOP_FLG = 0; /* 1 - stop count */ int CHAN = 1; /* current channel to output */ int fr[10] = {100,200,300,400,500,600,700,800,900,1000}; ...

92. http://www.ffl.msu.ru/students/courses/fl-teaching/39-medvedeva-delovoye-pismo.pdf

93. "Overall supercomputer performance analysis based on system monitoring data"

94. http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2012/Maklygin_Priezzhev_en.pdf

95. Comment on the International Jubilee Symposium

96. http://sn.sai.msu.ru/~sil/mydata/curvit.html

97. Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

98. FAQGnuGeneralPublicLicense < System < Foswiki

99. http://www.physcareer.ru/files/morgan_presentation2007.pdf

100. Foreword