... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... 2) Place of the conference has been changed from the lecture hall V-3 to the lecture hall V-2 in the First Academic Building of MSU on New Territories (it is marked on the map of MSU campus on the web-site). ... 6) For participants from abroad Russia here is additional information about the money exchange - we would recommend you to bring at least 300-400 euro with you in cash because of the following considerations: . ... for one dinner in the evening you should calculate not less than 15-20 euro ....

Еще в разделе: (Показать все результаты (>361) - polly.phys.msu.ru/ )

• Семинар по физике полимеров 1999
• Publications
• Mike Thamm - homepage

A list of excursions with approximate prices is available at the Academservice DMC site. ... you should send your request to Elena Demidova, elenadem@acase.ru , with the Subject: ACAT-2002: personal excursion Show your credit card number if you did not do that when ordered the hotel. There is a limited number of the tickets to the Bolshoi theater avalible via Academservice: . ... you should send your request to Oksana Tarasova, tarasova@top.sinp.msu.ru , with the Subject: ACAT-2002: the Circus . ...

Еще в разделе: (Показать все результаты (>64) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-04-Security1.pdf
• http://acat02.sinp.msu.ru/presentations/tuura/userguide.pdf
• http://acat02.sinp.msu.ru/presentations/tuura/userguide.ps

... Conferences . ... International Scientific Conference "Probability Theory and its Applications" on Occasion of the 85-th Birthday of Yu.V.Prokhorov is organized by the Steklov Mathematical Institute , Faculty of Computational Mathematics and Cybernetics of Moscow State University , and Institute for Informatics Problems of Russian Academy of Sciences from 12 to 14 of February, 2015. ... CMC MSU students at GSIS Summer School, Tohoku University, Japan . ... CMC MSU тИТ GSIS Tohoku IT Joint Seminar . ...

Еще в разделе: (Показать все результаты (>137) - en.cs.msu.ru/ )

• Laboratory of Inverse Problems | CMC MSU
• Laboratory of Inverse Problems
• Department of Functional Analysis and its Applications | CMC MSU

RMMA v3.2 RELEASE binary (806KB WinRAR Archive) . RMMA v3.1 RELEASE binary (753KB WinRAR Archive) . RMMA v3.0 RELEASE binary (740KB WinRAR Archive) . RMMA v2.5 RELEASE binary (387KB WinRAR Archive) . RMMA v2.4 RELEASE binary (366KB WinRAR Archive) . NOTE: These version should run on any WinNT -based platform. ... RMMA v2.3 binary (366KB WinRAR Archive) . RMMA v2.2b binary (365KB WinRAR Archive) . RMMA v2.1f binary (344KB WinRAR Archive) . ... The test should run fine now. ...

Еще в разделе: (Показать все результаты (>26) - www.kge.msu.ru/ )

... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...

Еще в разделе: (Показать все результаты (>26) - dynamo.geol.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>23) - www.chemport.ru/ )

. Frames are requied

Еще в разделе: (Показать все результаты (>3) - www.radio-msu.net/ )

• WWW Search

MSU . Science Park . ... Services . ... Projects & Partners . ... Companies . ... MSU Science Park provides services to innovative projects and companies in line with the following stages of development. Free consulting services are provided to authors of technology projects right at the outset (Pre-Seed) to help determine the overall strategy of the commercialization project, the intellectual property protection, selection of funding sources and effective team building. ... Company . ...

Еще в разделе: (Показать все результаты (>7) - www.sciencepark.ru/ )

• MSU Science Park - Venue & Space

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>7) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/rustexeo.html

The Chair of Mathematical Theory of Intelligent Systems and . Laboratory of Problems of Theoretical Cybernetics . ... MaTIS Chair . ... Research . ... Computer Solver . development of the Automatic solver of mathematical problems . ... Search in Databases . ... Here is a lecture notes in Russian by A.S. Podkolzin " Computer modeling by mathematical problems solving ". ... The Chair of Mathematical Theory of Intelligent Systems, Laboratory of Problems of Theoretical Cybernetics . ...

Еще в разделе: (Показать все результаты (>141) - www.intsys.msu.ru/ )

• Intelligent Systems :: Magazine
• Intelligent Systems :: Science :: Conference
• Intelligent Systems :: Magazine :: Web archive :: Volume 15, issue 1-4, 2011

Wireshark · · · · · (Win, Mac, Linux) Open Source (http://www.wireshark.org) · · · ( ) · 2 1 · # usermod ­a ­G wireshark user · wireshark root user@host:~$telnet ya.ru 80 Trying 213.180.193.3.. ... MAC 2. MAC IP ARP 3. L4 Interface # 1 2 3 4 Domain # 1 1 Eth Address 00:00:00:00:00:0a 00:00:00:00:00:09 IPv4 Address 10.0.1.2 10.0.1.1 10.0.2.2 10.0.0.3 Flow # 1 2 Src Itf # 1:49153 3:49153 Dst Itf # 4:234 1:432 Protocol TCP UDP Edges 1-2 1-2 .. ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/4-5utils.pdf
• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... This is a modification of the original Camera Calibration Toolbox for Matlab by Jean-Yves Bouguet that adds automatic calibration object detection to the functions of the original toolbox. ... The source code can be downloaded lower in this page. v0.31b Download GML Matlab Camera Calibration Toolbox 0.31 11.05.2005 Re-compiled and added correct OpenCV dlls . ... C++ Camera Calibration Toolbox . ...

Еще в разделе: (Показать все результаты (>165) - graphics.cs.msu.ru/ )

• GML MatLab Camera Calibration Toolbox | Лаборатория компьютерной графики и
• GML RANSAC Matlab Toolbox | Лаборатория компьютерной графики и мультимедиа
• Keyframe-based Depth Compression (Update) | Graphics and Media Lab

... Class . ... public class NetcdfFile . ... A concrete implementation of the Netcdf interface, this class provides connection to NetCDF version 1 files. ... NetcdfFile (java.io.File file, boolean clobber, boolean fill, Schema template) . ... Constructor Detail public NetcdfFile (java.io.File file, boolean clobber, boolean fill, Schema template) throws java.io.IOException . ... public NetcdfFile (java.lang.String path, boolean clobber, boolean fill, Schema template) throws java.io.IOException . ...

Еще в разделе: (Показать все результаты (>43) - angel.cs.msu.su/ )

• CoreIO
• DesktopManager
• : Class ConcreteIndexMap

Peer-review policies of the journal "Vestnik Moskovskogo Universiteta. ... Antropologia» Authors submit their manuscripts in printed format (2 copies) together with the electronic version ("*.rtf") on CD/DVD and via email. ... 11, Research Institute and Museum of Anthropology, Lomonosov Moscow State University, Deputy Editor of the journal "Vestnik Moskovskogo Universiteta. ... It is obligatory that the Editors send to authors copies of the reviews or motivated rejection of the manuscripts. ...

Еще в разделе: (Показать все результаты (>22) - www.anthropos.msu.ru/ )

MORPHOLOGICAL CATALOGUE OF THE CRATERS OF THE MOON . ... Coordinates, diameters and morphological features of 14 923 craters of the Moon in diameters 10 km and more are available in the catalogue. ... A lunar morphological crater catalogue was compiled by the Sternberg State Astronomical Institute in collaboration with the Unified institute of Nuclear Research, Dubna. ... 4. the presence of central peaks, ridges and mountains on the floor . ... peak and many mountains . ... many peaks, 1 mountain . ...

Еще в разделе: (Показать все результаты (>69) - selena.sai.msu.ru/ )

Graded Versions of Goldie's Theorem / Kanunnikov A.L. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>210) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Vestnik
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 3/2011

... List of participants . ... Academician of NAS of Belarus, Professor, Institute for Problems of Natural Resources Use and Ecology . ... Professor, Laboratory of Geoenvironmental Science and Engineering, Cornell University . ... Professor, Dept. of Soil Science and Agrochemistry, Rostov State University . ... Senior Scientist, Dept. of Chemistry, Div. of Organic Chemistry, Lomonosov Moscow State University . ... Professor, Head of Soil Chemistry Chair, Dept. of Soil Science, Moscow State University . ...

Еще в разделе: (Показать все результаты (>122) - mgumus.chem.msu.ru/ )

• IHSS-14

SPAW Editor PHP Edition version 1.0.6 Release Notes Thanks to everyone who downloaded, tried and supported SPAW Editor! This release includes several new features: css classes for tables, background images in tables and table cells, improved link dialog and more. ... If you are fluent in any of languages that are now included and see any typos or mistakes please report to spaw@solmetra.com Happy editing, Alan Mendelevich a.k.a. ailon alan@solmetra.com ...

Еще в разделе: (Показать все результаты (>6) - textbook.sinp.msu.ru/ )

• SPAW Editor documentation

... Program . ... Sarancka D. Использование дифференциальных уравнений при моделировании тундрового сообщества . ...

Еще в разделе: (Показать все результаты (>41) - pont2008.cmc.msu.ru/ )