... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... https://cs.msu.ru/node/1707 . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>23) - ani.cmc.msu.ru/ )

• Courses | Department of the Automation for Scientific Research CMC MSU
• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on
• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Рейтинг: 31 .net Framework опять косячит:( . ... Re: .net Framework опять косячит:( [ re: veranson ] . ... Re: .net Framework опять косячит:( [ re: nafig_batat ] . ...

Еще в разделе: (Показать все результаты (>15078) - www.fds-net.ru/ )

• Хитрый план. Final Version. - Public forum of MSU united student networks
• UT2004 (голосовки) - Public forum of MSU united student networks
• update to full version NOD 32 - Public forum of MSU united student networks

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ‘GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY’ aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>527) - www.geogr.msu.ru/ )

. [ Войти ] . Главная -> Фильмы -> Pok?mon Ruby Version . Пользователи . Демо . Деньги . Фильмы . Форум . Pok?mon Ruby Version . 2002 . отметить . Приключение . Игра . Боевик .

Еще в разделе: (Показать все результаты (>662) - kinfo.ru/ )

• Pok?mon: FireRed Version - Фильмы - Kinfo.ru
• Pok?mon: Emerald Version - Фильмы - Kinfo.ru
• Pok?mon Gold/Silver Version - Фильмы - Kinfo.ru

. The Camtasia Studio video content presented here requires JavaScript to be enabled and the latest version of the Macromedia Flash Player. If you are you using a browser with JavaScript disabled please enable it now. Otherwise, please update your version of the free Flash Player by downloading here . 2006-2010 Автор инструкции Миняйлов В.В. 2006-2010 Химический факультет МГУ имени М.В. Ломоносова .

Еще в разделе: (Показать все результаты (>2) - do.chem.msu.ru/ )

English version] [Русская версия] . ... Лаборатория основана в 1991 г., когда научно-исследовательская группа, занимающаяся изучением ферментов-целлюлаз на кафедре химической энзимологии химического факультета МГУ, получила статус лаборатории. ... Основные направления исследований, проводимых в лаборатории: . Энзимология, биохимия и биотехнология ферментов , осуществляющих биодеградацию природных полисахаридов: . ... исследование процессов адсорбции ферментов на нерастворимых субстратах; . ...

Еще в разделе: (Показать все результаты (>143) - www.enzyme.chem.msu.ru/ )

• Cellulase lab English version
• Entrez-PubMed
• PubMed medline query

Using stand-alone SDPfox . ... To add a new specificity group, type in the group name and press "Add" . To change composition of specificity groups, select two groups: first, from which to remove sequences, and second, to which to add sequences. ... For a constructed grouping, it is possible to run SDPgroup, re-randomize grouping or move sequences according to the best weights (see algorithm) under the link 'SDPgroup'. ... These sequences are likely to be re-grouped after SDPgroup is performed. ...

Еще в разделе: (Показать все результаты (>10) - bioinf.fbb.msu.ru/ )

... If you want to change the appereance, please edit <A HREF="./index.txt">index.txt (template) file</A>. CONVERT=convert -interlace line # IMAGE_FILE = index.txt #TEXT_COLOR=black #IMAGE_TYPE=jpg #VERSION=v. 0.40 #COL_NUMBER=3 #BG_COLOR=silver #SUB_DIR=vecher #EMAIL=havlik@ap.univie.ac.at # HOME =http://www.ap.univie.ac.at/users/havlik/Downloads #TAIL= P H1 A HREF =\ ../$$hr{INDEX}\ TARGET =\ $ TARGETS [0]\ UP /A A HREF =\ $$hr{ HOME }\ TARGET =\ $ TARGETS [0]\ ...

Еще в разделе: (Показать все результаты (>264) - www.pereplet.ru/ )

• About this document ...

... HUMLANG . ANNOUNCEMENTS . 20.12.2002 Book announcement . ... Reference Direct and Anaphoric . Alan Berger . In this book Alan Berger further develops the new theory of reference--as formulated by Kripke and Putnam--applying it in novel ways to many philosophical problems concerning reference and existence. ... The book is organized in three parts. ... Electronic Dictionary . New electronic dictionary "Religious Lexicon in Russian Poetry of Silver Age" (A-G) (add by V.P.Grigoriev) . ...

Еще в разделе: (Показать все результаты (>83) - old.philol.msu.ru/ )

• MSU-LGCLL:: Papers submitted to QUALICO-94
• HumLang Russian version
• Dmitry V. Khmelev: List of Publications

The database of triplet periodicity change points Y.M. Suvorova, E.V. Korotkov Centre of Bioengineering Russian Academy of Sciences, 117312, prospect 60 -tya Oktyabrya 7/1, Moscow, Russia, suvorovay@gmail.com It is well-known that triplet periodicit y (TP) is the dist inguishing feature of protein coding sequences of the majorit y of the living organisms [1]. ... The current version o f the database includes 179 238 records of protein coding sequences with triplet periodicit y change points. ...

Еще в разделе: (Показать все результаты (>275) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/101.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/107.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/158.pdf

. Русский . MCE-2016 . About Conference . Questions and Answers . Publications . Photogallery . Flash . HTML . Website creators . Contacts . Login: . Password: . Remember . Register . ! . Вопросы и ответы .

Еще в разделе: (Показать все результаты (>333) - www.mce.biophys.msu.ru/ )

• Gallery (HTML version)
• The dissertations didital library of the RSL: problems and solutions

. Operation Systems: MS Windows 3.x / 9x / NT . Hardware Requirements: 16 MB RAM (min) 12 Mb hard disk SVGA monitor CD-ROM mouse Latest Maintenance Releases: version 2.1 (16 bit), version 2.5 (32 bit) . 'Химический Верстак' Техническая Спецификация . Предыдущий слайд . Следующий слайд . Первый слайд . Графический вариант .

Еще в разделе: (Показать все результаты (>156) - www.chem.msu.ru/ )

• Dmitriy Mendeleev Online
• Mathematical Chemistry

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

CALL for PAPERS . September 29-October 2, 2005 Boston University, Boston, Massachusetts, U.S.A. The Central Eurasian Studies Society (CESS) invites PAPER and ROUNDTABLE proposals for the Sixth CESS Annual Conference, September 29-October 2, 2005, in Boston, Massachusetts. ... Paper and roundtable proposals relating to all aspects of humanities and social science scholarship on Central Eurasia are welcome. ... Deadline for Submission of Paper and Roundtable Proposals: April 1, 2005. ...

Еще в разделе: (Показать все результаты (>168) - www.prof.msu.ru/ )

• Some Ideas in Current Situation in our Country
• 1st Russian Fulbright Conference
• About the importance of founding teleecommunication centres in developing areas

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Dolgov S. , Khoromskij B.N. , Oseledets I. , Tyrtyshnikov E. в журнале Linear Algebra and Its Applications , издательство Elsevier BV (Netherlands) , ? ... Dolgov S. , Khoromskij B.N. , Oseledets I. , Tyrtyshnikov E.E. в журнале Journal of Computational Mathematics , издательство Zhongguo Kexueyuan (China) , том 30, ? ...

Еще в разделе: (Показать все результаты (>2231) - istina.msu.ru/ )

• Global and Planetary Change - журнал | ИСТИНА - Интеллектуальная Система
• Global Change Biology - журнал | ИСТИНА - Интеллектуальная Система
• Technological Forecasting and Social Change - журнал | ИСТИНА -

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>210) - ocl.sai.msu.ru/ )

List of Publications Elena A. Kudryavtseva March 2007 1. Gerver, M. L. and Kudryavtseva, E. A. (1995): A theorem on precedence relations generated by completely positive kernels. ... Russian Math. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2001): Intersection index of curves on surfaces and applications to quadratic equations in free groups. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2002): Ro ots of mappings on nonorientable surfaces and equations in free groups. ...

Еще в разделе: (Показать все результаты (>55) - dfgm.math.msu.su/ )

• Кудрявцева Е.А. / Кафедра Дифференциальной геометрии и приложений /

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>9) - lcc.chem.msu.ru/ )

... Cleo batch system is purposed to control parallel tasks on computer clusters. It controls one or more task queues. tasks sceduling (all MPI implemetations are supported, most other parallel environments are supported too) . ... controllable user limits (max used cpus, task work time, etc.) . ... Any task in main will be queued to daughter queues if there aren't enough free own cpus (not shared with daughters). When daughter queues will get enough cpus for this task, it will be runned in main . ...

Еще в разделе: (Показать все результаты (>2) - parcon.parallel.ru/ )

Домой :: Семинар по физике полимеров :: 1999 . ... S.S. Sheiko (Lab. of Organic Chemistry/Macromolecular Chemistry, University of Ulm). ... A. N. Ivanova, L. I. Manevich (Institute of Problem of Chemical Physics). ... S. I. Kuchanov, T. S. Zharnikov (Institute of Applied Mathematics, RAS, Moscow). ... S. G. Skuridin (Institute of Molecular Biology, RAS, Moscow). ... Prof. N. G. Korotkiy (Russian State Medical University) . ... 304. 6 мая: V.I.Volkov (Institute of Crystalography, RAS, Moscow) . ...

Еще в разделе: (Показать все результаты (>384) - polly.phys.msu.ru/ )

• Семинар по физике полимеров 1996
• International Workshop "Theory and Computer Simulation of Polymers: New
• LCOptimizer Software