Nowadays one of the pronounced tendencies in the language policy (language plannin g) of all English-speaking countries is the development and wide spreading of the so-called inclusive language based on the principle of political correctness. ... 1990. ... Buffalo, 1995. . ... inclusive language). " " . ... father, son, son of man, man, brother .. he they. ... URL: http:/www.academia.org/lectures/lindl.html ( : 15.04.2008). ... URL: http://www.cbmw.org/Resources/Articles ( : 19.12.2011). , , , , , , . ...

Еще в разделе: (Показать все результаты (>126) - ffl.msu.ru/ )

• About Us

MSU . Science Park . ... Prototyping center . Engineering formula . ... Center for Youth Innovation Creativity and Prototyping at Moscow State University Science Park is focused on work with pupils and students to familiarize them with the capabilities of modern equipment and engaging in scientific and technical activities. ... The main goal of the Center - provide opportunities for children and young people to fulfill themselves in scientific and technical work. ... JSC "MSU Science Park" . ...

Еще в разделе: (Показать все результаты (>12) - www.sciencepark.ru/ )

• MSU Science Park - News
• MSU Science Park - Projects & Partners
• MSU Science Park - About us

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>87) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/Basic_IP2_Win_Tutorial.pdf
• http://geophys.geol.msu.ru/STUDY/manual/ip1dmine.doc

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>31) - ideas.msu.ru/ )

... Alexei Lidov.. ... The creation of sacred space as a form of creativity and subject of cultural history .. ... 91 Mikhail V. Bibikov Byzantine Eden: "time in space" .. ... 140 Svetlana Popovi The Byzantine Monastery: its Spatial Iconography and the Question of Sacredness .. ... 525 762 Milena Rozhdestvenskaya The Creation of Sacred Space in Medieval Russian Literature: apocrypha and chronicles .. ... 556 Vladimir V. Sedov The Sacred Space of the Medieval Russian Church: the Architectural Aspect .. ...

Еще в разделе: (Показать все результаты (>17) - imk.msu.ru/ )

• Институт мировой культуры МГУ

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>7) - psyberlink.flogiston.ru/ )

... The international conference " Differential Equations and Topology " devoted to the 100th Anniversary of the birthday of Lev Semenovich Pontryagin was held in Lomonosov Moscow State University, June 17-22, 2008. Head of the ASR Department RAS Corresponding Member Dmitry P. Kostomarov had a talk "Problems for Ultrahyperbolic Equations in Half-Space" [ PDF 413.47 KB ] on June 22nd at the subsection "Partial Differential Equations" of "Differential Equations" section. ...

Еще в разделе: (Показать все результаты (>12) - ani.cmc.msu.ru/ )

• English edition of the ASR Department website
• Alexander Pozdneev at the ASMS 2008 Conference
• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on

... The international conference " Differential Equations and Topology " devoted to the 100th Anniversary of the birthday of Lev Semenovich Pontryagin was held in Lomonosov Moscow State University, June 17-22, 2008. Head of the ASR Department RAS Corresponding Member Dmitry P. Kostomarov had a talk "Problems for Ultrahyperbolic Equations in Half-Space" [ PDF 413.47 KB ] on June 22nd at the subsection "Partial Differential Equations" of "Differential Equations" section. ...

Еще в разделе: (Показать все результаты (>6) - ani.cs.msu.su/ )

• English edition of the ASR Department website
• Alexander Pozdneev at the ASMS 2008 Conference
• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on

... Inorganic Materials Sciences . ... At the same time at the Faculty of Physics and Mathematics of the Moscow University was founded the Inorganic Chemistry Division which was later transformed into a separate Department of Inorganic Chemistry of the MSU Faculty of Chemistry . ... The latter part of this program is successfully realized at both the Deartment and at the Department of Materials Sciences , the new faculty of MSU, which creation was initiated by the department of Inorganic Chemistry. ...

Еще в разделе: (Показать все результаты (>11) - www.inorg.chem.msu.ru/ )

Department of Russian History of the 20th Century . ... The department ’s faculty traditionally gives a general course of lectures on 20th century Russian history for both full time and part time students in their third year in the faculty of history , the faculty of journalism, the institute of African and Asian countries, in the faculty of sociology, and in the preparatory branch of MSU; for students of the department of 20th century Russian ...

Еще в разделе: (Показать все результаты (>37546) - hist.msu.ru/ )

• Center for Ukrainian and Belorussian Studies, Faculty of History, Moscow State
• Department of Ancient Languages
• The Rural Roads as the Structural Element of the Roman Organization of Land

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

... THE LJUBLJANA SUMMER SCHOOL 2006 . ... THE LJUBLJANA SUMMER SCHOOL 2006 is a new intensive programme open to both undergraduate and graduate students of Business, Economics, and other fields of Social Sciences. The programme was created at the Faculty of Economics in Ljubljana in order to impart knowledge by taking full advantage of our country s unique geographical position: the meeting point of East and West. ... The Summer School s aim is to learn by applying knowledge to real-life situations. ...

Еще в разделе: (Показать все результаты (>73) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова
• Преподаватель ВШБ МГУ Вячеслав Болтрукевич выступил на конференции EFMD
• Конкурс на лучшее эссе года

Sign in Register . ... Resources . ... Forums . ... 495) 3334-65-56 . info@ecfs.msu.ru . All contacts . ... Home Forum . ... Search in section Everywhere Основная дискуссия -Ongoing consultations/ Текущие онлайн конференции -Прошедшие онлайн конференции -Общая дискуссия -Евразийское почвенное партнерство . ... Основная дискуссия . Ongoing consultations/ Текущие онлайн конференции . ... Прошедшие онлайн конференции . ... Общая дискуссия . ... The Department of land resources . ... Forum . ...

Еще в разделе: (Показать все результаты (>20) - ecfs.msu.ru/ )

• Ongoing consultations/ Текущие онлайн конференции | ECFS
• Director | ECFS

. Veronika K. Laurinavichyute . /Lunina/ . Senior Scientific Researcher, PhD . CV . Selected Publications . News: . 12.08.2013. - Page updated 20.07.2013. - Project GRAVITSAPA started 01.07.2013. - Published: Practical exercises in physical chemistry. MGPU. Part 2. 2013 16-21.06.2013. - Workshop on composite materials, Harbin 10.04.2013. - On-line publication: Electrochimica Acta (2013), pp. 102-107 23.03.2012. - Website created! . nika@elch.chem.msu.ru . +7(495)939-1321 . Back

Еще в разделе: (Показать все результаты (>68) - electr003.chem.msu.ru/ )

On-line Data . COHO data . ... PIONEER 10 . ... PIONEER VENUS ORBITER . OMNI data . OMNI Data Set . LASRE data . CORONAS-I (electrons) . CORONAS-I (protons) . ... COSMOS 1686 (electrons) . COSMOS 1686 (protons) . ... Satellite Informations Selector . ... AKEBONO AMPTE Cluster II / Phoenix DMSP Dynamics Explorer (DE) Equator-S FAST Freja GOES-7 GOES-8 Geotail Hawkeye IMAGE (GSFC) IMAGE (SwRI) IMP-8 ISEE Interball LANL MSX Oersted POLAR SAMPEX SOHO UARS Ulysses Voyager WIND . ...

Еще в разделе: (Показать все результаты (>19) - dbserv.sinp.msu.ru/ )

• ULYSSES Online Data Set Selector
• BAFIZ at SINP MSU

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... International . ... Partners . ... All partners . ... International media readings . The 6th International Media Readings in Moscow "Mass Media and Communications 2014" . ... Organizers: Faculty of Journalism, Lomonosov Moscow State University . ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>40) - www.journ.msu.ru/ )

• Students of the Faculty of Journalism, MSU Visited the Humboldt University of

О лаборатории . ... Лаборатория теоретической биофизики . ... This Python module parses Gaussian cube files, produced by quite a few QM software packages, and makes volume data available as numpy array as well as some associated properties. ... Нет комментариев " Gaussian Cube files loader " . ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>28) - erg.biophys.msu.ru/ )

• PyMol script for scanning potential energy surfaces ERG Research Group:
• Lipid membrane MD modeling with GROMACS ERG Research Group: Лаборатория
• membrane ERG Research Group: Лаборатория теоретической биофизики

. Faculty of Mechanics and Mathematics, . M.V. Lomonosov Moscow State University . This site is created and supported by . the A.M. Liapunov French-Russian Institute . of Moscow State University .

Еще в разделе: (Показать все результаты (>22) - new.math.msu.su/ )

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>12) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/literature/WOS.pdf

ACCL: what is that and what it is for . Animal Cell Culture Laboratory (ACCL) of the Faculty of Bioengineering and Bioinformatics was created in 2001 as one of the first service groups located in Laboratory Building Б of Moscow State University . ... Other persons are also welcome on the terms of individual agreement (see Services and Scientific Program ). We also have our own program of scientific research (see Scientific Program ). ...

Еще в разделе: (Показать все результаты (>169) - www.genebee.msu.ru/ )