ALGORITHM FOR SIGNS SET OPTIMIZATION TO SOLVE CLASSIFICATION PROBLEMS Akinin P.V., Karp V.P. Moscow State Institute of Radio-Engineering, Electronics and Automation, Faculty of Cybernetics, Information Systems Dept., ... In such cases, there is a need to optimize the signs set [1]. The idea of the algorithm is based on two iterative procedures: signs collection signs exception. ... Then for the sign given another one, which demonstrates together with the first one the best Q estimation, is added. ...

Еще в разделе: (Показать все результаты (>290) - www.mce.biophys.msu.ru/ )

• Gallery (Flash version)
• Gallery (HTML version)
• The dissertations didital library of the RSL: problems and solutions

... BBK 22.6 G 12 UDK 37:[52+53] (076.1) G 12 Gavrilov M.G. / Zviozdnyj Mir: Sbornik zadach po astronomii i kosmicheskoj fizike. ... Here is volume IV – problems of the Olympiads of Scientific Centre in Chernogolovka (former Noginsk Scientific Centre). ... Russian introduction INTRODUCTION Olympiad for high schools students is one of interes- ting traditions of Chernogolovka: a small picturesque villa- ge not far from Moscow, in which the Scientific Center of the Russian Academy of Sciences is situated....

Еще в разделе: (Показать все результаты (>25) - www.issp.ac.ru/ )

• II International Astronomy Olympiad, Problems to solve
• IO of EAAS, Problems to solve (In Russian)
• II IO of EAAS, Problems to solve (In Russian)

... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....

Еще в разделе: (Показать все результаты (>6) - biophys.phys.msu.ru/ )

Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>75) - old.philol.msu.ru/ )

• HumLang Russian version
• Dmitry V. Khmelev: List of Publications
• HUMLANG - announcements

News and Events . Bat Research . Russian Bats . ... Here we propose to post our web page updates and provide information on events happening in Russian bat research not directly connected with this site (conferences, symposia, new publications etc.), which may be of interest to our visitors. This page consists of the following topics: MAIN NEWS , NEW PUBLIC EVENTS (Conferences etc.) BAT RESEARCH NEWS , information on NEW PUBLICATIONS , . ... NEWS OF THIS WEB SITE . ... Bats of Vietnam. ...

Еще в разделе: (Показать все результаты (>1321) - zmmu.msu.ru/ )

• Russian bat research history
• Специалисты по рукокрылым
• Сайт РГР и его авторы

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>4) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

... Department of Vertebrate Zoology . Department of Vertebrate Zoology is one of the oldest departments of the Biological Faculty of Lomonosov Moscow State University. ... The students improve their practical skills in the courses of Microtechniques, Computer Methods in Biology and Methods of Field Research. ... The Department includes five research laboratories. ... Laboratory of Vertebrate Behaviour conducts research on the development of behavioural interactions in the higher vertebrates. ...

Еще в разделе: (Показать все результаты (>618) - vertebrata.bio.msu.ru/ )

• Sergei V. Ogurtsov
• Background of the Department
• Выступления студентов и аспирантов на конференциях

The Journal "Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika" is a periodical scientific publication that reflects the topics of the important directions of theoretical studies in mathematics and mechanics in the M.V. Lomonosov Moscow State University. ... The Founders of the Journal "Vestnik Moskovskogo Universiteta. ... Mekhanika" are the M.V. Lomonosov Moscow State University and the Faculty of Mechanics and Mathematics . ... Faculty of Mechanics and Mathematics . ...

Еще в разделе: (Показать все результаты (>209) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 3/2013

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... ndsipu.cmc.msu.ru . ... The Department conducts research in the field of the modern theory of dynamical systems and control of nonlinear objects. ... the theory of nonlinear dynamical systems; . the nonlinear analysis in control theory and optimization; . ... Various directions which are connected with the analysis of nonlinear dynamic systems and their properties, together with the study of a wide range of control problems of complex systems are being developed at the Department. ...

Еще в разделе: (Показать все результаты (>144) - en.cs.msu.ru/ )

• Department of Nonlinear Dynamic Systems and Control Processes
• International Scientific Conference "Probability Theory and its Applications"
• Laboratory of Inverse Problems | CMC MSU

The Octotron Approach: Towards Autonomous and Reliable Operation of Supercomputers Alexander Antonov, Dmitry Nikitenko, Pavel Shvets, Sergey Sobolev, Konstantin Stefanov, Vadim Voevodin, Vladimir Voevodin, Sergey Zhumatiy Research Computing Center, Lomonosov Moscow State University, Moscow, Russia {asa,dan,shpavel,sergeys,cstef,vadim,voevodin,serg}@parallel.ru 1 Introduction ... 2 The Octotron System: Model-based Approach Octotron represents the supercomputer model in the form of a graph (Fig. ...

Еще в разделе: (Показать все результаты (>53) - hpc.msu.ru/ )

... 15 March 2002: Deadline for abstract submission . ... 1 June 2002: Deadline for advanced registration . ... For the advanced registration, the payment should be made by bank transfer to MI bank which is placed in Moscow. ... Registration fee for ISNA-16 from LAST NAME, INITIALS, COUNTRY " . Please note that the registration fee ($250 before June 1, 2002, and $300 after this date, $75 for students) does not include additional bank transfer fees that may be charged by some banks. ...

Еще в разделе: (Показать все результаты (>199) - acs366.phys.msu.su/ )

• Abstract

... Кафедра общей ядерной физики . ... НИИЯФ МГУ . ... С июня 2009 года в коллаборации принимает участие группа Московского Государственного Университета. ... 7-9 октября 2011 года наша группа приняла участие в VI-м Фестивале науки . ... Пароли , при необходимости, можно получить у администрации сайта по e-mail. 6-10 июня 2011 года на физическом факультете МГУ состоялось очередное Совещание коллаборации ANTARES, с участием более чем 70-ти членов коллаборации из 8-ми стран. ... 22-25 ноября 2010 года . ...

Еще в разделе: (Показать все результаты (>26) - antares.sinp.msu.ru/ )

List of Publications Elena A. Kudryavtseva March 2007 1. Gerver, M. L. and Kudryavtseva, E. A. (1995): A theorem on precedence relations generated by completely positive kernels. ... Russian Math. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2001): Intersection index of curves on surfaces and applications to quadratic equations in free groups. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2002): Ro ots of mappings on nonorientable surfaces and equations in free groups. ...

Еще в разделе: (Показать все результаты (>55) - dfgm.math.msu.su/ )

• Кудрявцева Е.А. / Кафедра Дифференциальной геометрии и приложений /

... cheap longchamp . ... cheap ray bans . cheap moncler . ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate key Win 7 ultimate product key windows 7 key sale win 7 ultimate product Key Windows 7 key ultimate win 7 ultimate ...

Еще в разделе: (Показать все результаты (>143) - elana.sinp.msu.ru/ )

• cheap moncler The new version also offers enhanced automated orchestration
• Next Update Suggestions | С Днем Победы!