. Compiled from literature sources . version 1.0 . Scientific name . Family . English common name . Native common names . General use . Specific uses . Reference

Еще в разделе: (Показать все результаты (>217) - herba.msu.ru/ )

• Vascular plants' distribution on the islands
• Moscow State University, Geobotany dpt. - View Staff

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>122) - lnfm1.sai.msu.ru/ )

• Division of the Galaxy and Variable Stars
• Natural Satellites Data Center. Objectiv.

... GOES corrected results are wrong, because the publication Smart D.F. and M.A. Shea, Comment on the use of GOES solar proton data and spectra in solar dose calculations, Radiation Measurements 30 (1999) 327-335 was erroneous (see "The issues...." above. ... The criticism of the use of the log-normal distribution for the data fit in Feynman et al. is excessive. Indeed, Feynman et al. use only the high intensity part for the fit making the results almost independent of the low energy part. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

... Moscow University Search Engine . AstroSearch - search astronomical sites . Open FTS search engine . MailWare (PostgreSQL mailing list archive) Our commercial interests . ... This full text search engine by XWare team provides the document search over all Moscow State University Web sites. ... OpenFTS (Open source Full Text Search) is an advanced PostgreSQL-based search engine that provides online indexing of data and relevance ranking for database searching. ... 2001-116 XWare Team. ...

Еще в разделе: (Показать все результаты (>2116) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"
• Abell 2744: Pandoras Cluster of Galaxies

... Summury: Usually a water column consists of two big layers. The upper layer (10-50 m deep) is characterized by strong mixing, as a result, both the biomass and nutrients are nearly uniformly distributed there. ... In this article we show that in the presence of an upper mixed layer (UML) there can be two stable vertical distributions of phytoplankton biomass: either the bulk of the biomass is located within the upper layer or below it. ...

Еще в разделе: (Показать все результаты (>41) - chaos.phys.msu.ru/ )

• Alexey Ryabov. Research

.

Еще в разделе: (Показать все результаты (>8) - www.chemport.ru/ )

... 2015 . ... The author uses the methods and approaches of redistribution economy in the analysis of the development of timber industry of the Karelian ASSR in the mid 1960s. The role of the Institute of Redistribution as a major factor of regional economy in the system of relations between the Center and Region was examined using unique archival materials never before analyzed scientifically. ... Redistribution economy, institute of redistribution, timber industry, Karelian ASSR. ...

Еще в разделе: (Показать все результаты (>16) - ee-journal.spa.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

... TWiki ? ... Adding, renaming and deleting webs are all web-based operations. ... There are two methods used to create a new web. ... All topics in the template web will be copied into your new web. ... You can create hierarchical webs via the Adding a New Web form above, by using a slash- or dot-separated path name which is based on an existing web name in the Name of new web: field. ... To create a subweb named Bar inside a web named Foo , use Foo/Bar or Foo.Bar as the new web name in the form...

Еще в разделе: (Показать все результаты (>21985) - dualopt1.cmm.msu.ru/ )

• TWikiUpgradeGuide - TWiki - TWiki
• %TOPICTITLE% (33 vs. 34) - TWiki

This module provides for user authentication using text files. ... Available after Apache 1.3.20] The supplied username and password must be in the AuthUserFile database, and the username must also match the system's name for the owner of the file being requested. ... Available after Apache 1.3.20] The supplied username and password must be in the AuthUserFile database, the name of the group that owns the file must be in the AuthGroupFile database, and the username must be a member of that group. ...

Еще в разделе: (Показать все результаты (>58) - neptun.sai.msu.ru/ )

• Apache modules
• Why We Took PEM Out of Apache
• Apache module mod_auth_dbm

... Nonlinear Standing Waves in an Acoustical Resonator with the Longitudinal Mean Temperature Distribution . ... This paper deals with the problem of nonlinear standing waves in the axisymmetrically shaped acoustic resonators where a mean temperature is distributed along their axis. ... The one-dimensional model equation for nonlinear standing waves of the 2-nd order including a viscous boundary layer is modified to take into account a longitudinal distribution of mean temperature. ...

Еще в разделе: (Показать все результаты (>53) - acs366.phys.msu.su/ )

FEATURES OF THE HYDROGEN DISTRIBUTION AROUND LUNAR CRATERS PROCLUS AND KEPLER. ... In result of analysis of the data Lawrence and Feldman constructed the hydrogen distribution on the lunar surface [1]. ... However, the authors shown, that EN flux data features may be explained by other element abundance in the lunar soils, namely: Si, Ca, Gadolinium (Gd), Samarium (Sm) and Fe. ... Using of the Feldman's interpretation of the Lunar Prospector data [8], we constructed hydrogen distribution map (Fig.1). ...

Еще в разделе: (Показать все результаты (>77) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Pug/Publications/Pugacheva%20LPS%2041.pdf
• http://selena.sai.msu.ru/Rod/Publications/ms34/MS059.pdf
• http://selena.sai.msu.ru/Rod/Publications/ms34/MS060.pdf

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>10) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/2010_Amsterdam_Kulikovskiy.pdf
• http://antares.sinp.msu.ru/docs/Shirokov%20-%20The%20first%20results%20of%20MSU%20groups%20in%20ANTARES%20project.pdf

Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>35) - old.philol.msu.ru/ )

• MSU-LGCLL:: Krylov J.K.- Three Laws of Fiction Prosaic Texts Organization

... 7 (495) 939-16-82 info@physics.msu.ru . ... Japan), and Univ. of Oulu (Finland) demonstrated that a power-law size distribution with large-size cutoff, as observed in Saturn's rings, is universal for systems where a balance between aggregation and disruptive collisions is steadily sustained. ... We show that a power-law size distribution with large-size cutoff, as observed in Saturn's rings, is universal for systems where a balance between aggregation and disruptive collisions is steadily sustained....

Еще в разделе: (Показать все результаты (>44) - phys.msu.ru/ )

... Sbjct : 9135 ctggc 9131 Database : thr Posted date: Feb 20, 2008 8:14 PM Number of letters in database : 12,243,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 142,083 Number of extensions: 8872 Number of successful extensions: 67 Number of ...

Еще в разделе: (Показать все результаты (>1437) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm.blast
• http://kodomo.fbb.msu.ru/~element/Term3/gomolog.txt

Database on charge transfer in DNA V.D.Lakhno, E.V.Sobolev, N.S.Fialko, V.V.Baryshnikov, L.A.Kirzhemanov (Pushchino, Moscow Region) The Institute of Mathematical Problems of Biology, RAS has been engaged in the studies on modeling charge transfer in DNA for several years. ... 10, 2002, .188-195 database could be used to diagnose genetic diseases, to calculate elements of circuits in DNA-based nanoelectronic devices, etc. ... Web- SSH-. ... User Mode Linux) SSL (Secure Socket Layer) SSH (Secure Shell). ...

Еще в разделе: (Показать все результаты (>90) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc32111/doc.pdf
• http://www.mce.biophys.msu.ru/archive/doc185146/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc57324/doc.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out

... Форумы > Книжная барахолка > Тема . ... Форумы Список тем Новая тема . ... Продам: Книгу с курса Microsoft - Administering a Microsoft SQL Server 2000 Database . Продам книжку с официального учебного курса Microsoft . M2072 Administering a Microsoft SQL Server 2000 Database на англиском языке за 200$ c дисками за 265$ (4 диска - 2 учебных и 2 установычных для SQL базы) торг. т.926-529-14-13 . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>65) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Research assistant in a world leading

... Miklukho-Maklaya 16/10, Moscow, 117997, Russia, +7(495)3366455, alexei@nmr.ru . ... Analysis of PS microdistribution in tissues as a function of time after PS injection (topical or oral application) helps to characterize a selectivity of PS accumulation in tumor cells and other tissue structures; to reveal correctly a maximum of time profile of its tumor accumulation and to recognize the features of PS tissue distribution (spatial and temporal) at different ways of PS application. ...

Еще в разделе: (Показать все результаты (>17) - www.msm.biophys.msu.ru/ )