.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>65) - www.intsys.msu.ru/ )

• Installation
• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles

... 2015 . ... Graduate student, School of Public Administration, Lomonosov Moscow State University. ... The problem of creating a complete concept of strategic positioning and image of Russia image becomes more and more urgent. The purpose of this article is to identify the role of public image in the implementation of the state policy and, at the same time, to analyze the state policy as an instrument of public image formation. ... Public policy, public image, state policy in sports. ...

Еще в разделе: (Показать все результаты (>209) - ee-journal.spa.msu.ru/ )

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>243) - astro.uni-altai.ru/ )

• Kiev University Observatory

Modeling of single top tW+b signal at the LHC Slava Bunichev Moscow State University In collaboration with E. Boos and L. Dudko http://comphep.sinp.msu.ru Single top quark production at the LHC: leading order diagrams for single top production t-channel s-channel associated tW production Single Top tWb processes at the LHC: tWb channel gives a significant contribution to the Single Top signal at the LHC Discriminate single top tWb and tt-bar events 2. ...

Еще в разделе: (Показать все результаты (>131) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>114) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD
• Online Registration

Space Weather Research in China and Introduction of CSSAR J. Cao (E-mail: jbcao@center.cssar.ac.cn) 1. ... Some important parameters of space environment are obtained, such as high energy charged particles (electrons, protons and heavy ions), single event upset, radiation dose, space plasma, surface charging, deep dielectric charging, upper atmosphere density and components, solar electromagnetic radiation and etc. ... The particle detectors soon detected the solar high energy particle fluxes. ...

Еще в разделе: (Показать все результаты (>9) - dbserv.sinp.msu.ru/ )

• Magnetosphere

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Рейтинг: 43 . New CPU installed . ... Рейтинг: 9289 . Re: New CPU installed [ re: rosablanca ] . ... Re: New CPU installed [ re: Panzer ] . ... Рейтинг: 5344 . ...

Еще в разделе: (Показать все результаты (>1445) - www.snto-msu.net/ )

• The Windows product key installed on this computer is not genuine - Public
• продам финансовый калькулятор Texas Instruments BA II - Public forum of MSU
• Синтезаторы/Сэмплеры от Native Instruments ищу очень сильно. - Public forum of

new-mac ]] . ... Instructions for Installing CompHEP under OSX . ... Be aware, that Mac OS ix not Linux, installation of any GNU (or GNU-based) software can cause problems! ... go to Fink ( http://fink.sourceforge.net/ or any other GNU software repository), download the fink application and БЂњFink CommanderБЂќ, and then use this to download the binary files for: gfortran (fortran 77 compiler) . download the last version of the software from the comphep web site, http://comphep.sinp.msu.ru . ...

Еще в разделе: (Показать все результаты (>23) - comphep.sinp.msu.ru/ )

• faq [CompHEP]

Courses Overview Human resources management (English) The course is aimed at creating an overall understanding of human resources (HR) management system. ... Key topics: main theories and concepts of human resources management, personnel planning, HR policies, personnel selection and hiring, personnel development, career management. ... Insurance and risks The course presents an overview of economic, legal, and administrative bases of insurance. ... Key topics: depending on a company profile. ...

Еще в разделе: (Показать все результаты (>50) - www.mgubs.ru/ )

• http://www.mgubs.ru/images/Image/Courses%20overview.pdf

... Further tests of the radiocarbon method of age determination (1 3, 6, 8,1 0) for archaeological and geological samples have been completed. All the samples used were wood dated quite accurately by accepted methods. ... TABLE 1 Age Determinations on Samples of Known Age . ... Specific activities for samples of known age. ... The former sample was cypress wood and the latter acacia. ... This committee advised us what samples of known age to use for testing and greatly assisted us in procuring them. ...

Еще в разделе: (Показать все результаты (>92) - hbar.phys.msu.ru/ )

• Historical Eclipses

... 12, 43 ­ 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...

Еще в разделе: (Показать все результаты (>36) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-102.pdf
• Maxim V. Shamolin Home Page

... January 6, 1996 . Dwarf Elliptical Galaxy M32 . ... Explanation: Being the largest galaxy around can sometimes make you popular. ... M31 , the Andromeda galaxy, is the largest galaxy in our Local Group of galaxies - even our tremendous Milky Way Galaxy is smaller. ... M32 is a dwarf elliptical galaxy . Elliptical galaxies have little or no measurable gas or dust - they are composed completely of stars and typically appear more red than spiral galaxies . ... About APOD | ...

Еще в разделе: (Показать все результаты (>37) - www.arcetri.astro.it/ )

• APOD: 2000 December 29 - The Dark Horsehead Nebula
• APOD: August 6, 1998 - Infrared Horsehead
• APOD: July 9, 1999 - NGC 7789: Galactic Star Cluster