The essence of VES data processing may be shown on a flexure fold model (The central part of model is shown on fig.6). 2D modeling data for the flexure fold added with NSI were processed with the IPI-2D package, but at first example deep objects resistivities were made equal to surrounding to neglect their influence. ... Full model of flexure fold with NSI and deep objects . ... Comparison of apparent resistivity fields after filtering (a) and calculated without NSI (b) . ...

Еще в разделе: (Показать все результаты (>76) - geophys.geol.msu.ru/ )

• Anis. Page2

Cooperation with Third Country participants Cooperation with Third Country Participants in an EC funded FP7 multi-partner research project1 - Practical Advice for Proposal Submission and Negotiation ­ What are Third Country Participants in this context? ... For a complete list of associated countries see ftp://ftp.cordis.europa.eu/pub/fp7/docs/third_country_agreements_en.pdf. ... 2 Cooperation with Third Country participants account by the coordinator already at the proposal stage. ...

Еще в разделе: (Показать все результаты (>34) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/EPSS_guide.pdf

... NH2 2, O2 P2 . ... Arg114 . ... Arg 3 . ... 100% . ... NH2 2, O1P2 . 2.89 . ... ND2 2, O1P2 . ... NZ 2, O1P2 . ... G1291 . OD1 2, O1P2 . ... Arg 102 . ... Arg 119 . ...

Еще в разделе: (Показать все результаты (>8) - rnp-group.genebee.msu.ru/ )

... Robert Hermann Brookline, MA (Received November 22, 1999) der to illustrate the obvious progress, one can mention a variety of examples. ... In or- FYI Item "BMS Report on Institutes" As a member of the panel commissioned by the Board on Mathematical Sciences of the National Research Council, I write to correct several inaccuracies in the "For your information" note by Allyn Jackson entitled "BMS Report on Institutes" in the December 1999 issue of the Notices. ...

Еще в разделе: (Показать все результаты (>68) - chaos.phys.msu.ru/ )

... Armenia, 0048, Yerevan, Davidashen 25 . ... The present work is dedicated to development of new polymer compositions used to protect units of atomic techniques and environment by means of deactivation of various surfaces from ?-, ?-, ?-radioactive pollutions. ... In both cases (applications) mechanism of ionizing radiation influence is determined by general principles of its interaction with organic molecules and organic-inorganic structures of macromolecules. ... 2007 Biophysics dep., ...

Еще в разделе: (Показать все результаты (>93) - www.msm.biophys.msu.ru/ )

... В рамках данного спецкурса особый интерес представляют первые две части, которые входят также в книгу "Programming Language Theory and its Implementation". schemers.org . Scheme портал . The Internet Scheme Repository at the Indiana University. An Introduction to Scheme and its Implementation by Prof. Paul R. Wilson . Web and CGI Programming in Scheme . XPath и XSLT на Scheme (SXML). ... Использует Kawa , реализацию Scheme на Java. ...

Еще в разделе: (Показать все результаты (>144) - sp.cs.msu.ru/ )

• HPF DVM. Language specification
• Специальный курс Методы управления транзакциями в современных СУБД
• DVM-system. Goals and structure

Firefly (previously known as the PC GAMESS) is a freely available ab initio and DFT computational chemistry program developed to offer high performance on Intel-compatible x86, AMD64, and EM64T processors. ... At moment, Firefly includes no more than 5% of the legacy code. ... Firefly is freely available for all main PC operating systems: Windows, Linux, and Mac OS X. Firefly supports various Windows versions including Windows 8, Windows 7, Windows Server 2008, Vista, 2003, XP, 2000, NT, and 98/Me. ...

Еще в разделе: (Показать все результаты (>86) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - running in parallel using LAM/MPI
• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using
• Firefly v. 8.0.0 documentation - XP parallel modes of execution

... TernAPI program . ... TernAPI program is designed for ternapy phase diagrams calculation by means of the convex hull method. ... Quick calculation of isobaric-isothermal sections of ternary systems phase diagrams (1-30 sec.) ... Voskov A.L., Dzuban A.V., Maksimov A.V. TernAPI program for ternary phase diagrams with isolated miscibility gaps calculation by the convex hull method // Fluid Phase Equilib . ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>11) - td.chem.msu.ru/ )

... Alexander A. Moskovsky . ... Software Designer : . ... Projects: . Janitor II, Custodian III for Matrix Logic - utilities for DOCS Open EDMS (electronic document management system), C++/Win32 platform. ~2 man-year project with 5 persons team. iBuzz - (for ibuzz.com ) large client-server system (Win32, Enterprize Java Beans, Oracle, Sun/Solaris). ... Lunch Ordering Web System. ... Software Resources International , former Digital Moscow Software Center, . ... Physical Chemistry chair, . ...

Еще в разделе: (Показать все результаты (>5) - lcc.chem.msu.ru/ )

... About CIE MSU . Academic Programmes . Admissions . ... Vestnik CIE (in Russian) . FAQs (in Russian) . ... Center For International Education . ... Documents Confirming Academic Background . Students having the school completion certificates and the secondary school matriculation certificates received abroad are to get nostrification certificate for these documents. ... 4. two copies of notarially certified translation into Russian of the documents on education and appendices to it. ...

Еще в разделе: (Показать все результаты (>31) - www.cie.ru/ )

... MSU Web Sites . ... Study and Research . ... 119992,Russian Federation, Moscow, MSU, Lenin Hills 1-51, 7-th floor, room 752, Higher school of modern social sciences . ... The Higher School of Modern Social Sciences (faculty) (VSHSSN) was established in 2006. ... Central disciplines include Sociology of knowledge, Economy of knowledge, Social management, Social control, State audit, Translation of the professional text. ... Sociology of management . ... Social sciences (Sociology of management). ...

Еще в разделе: (Показать все результаты (>138) - www.msu.ru/ )

• Specialist studies
• Bachelor studies
• INSTITUTE OF ASIAN AND AFRICAN STUDIES

... The Laboratory of Programming Technologies was established in 2001. The Laboratory's team consists of collaborators and graduate students of Computer System Automation Department that work under supervision of Professor Igor Mashechkin. ... series of works for research and development of multi-functional cross-programming system. ... Presently the main scientific direction of the Laboratory is research and development of algorithms and methods for creating data mining software. ...

Еще в разделе: (Показать все результаты (>117) - en.cs.msu.ru/ )

• Laboratory of Programming Technologies | CMC MSU
• Laboratory of Industrial Mathematics
• Laboratory of Industrial Mathematics | CMC MSU

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>26) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Nhunt

... Preface to Research Project "High-Level Decision Making in the Soviet Administrative-Command Economy", . ... This introductory article summarizes the High-Level Soviet Decision Making Project of which the Lazarev and Belova papers are examples. It explains that social scientists must use the modern methods of information economics and the New Economic History to study the Soviet state and party archives using methods of interests to economists and political scientists in general. ...

Еще в разделе: (Показать все результаты (>175) - hist.msu.ru/ )

• Moscow State University. Faculty of History. An Application
• Department of the History of Russian Social Movements and Political Parties
• Moscow State University. Faculty of History. About us.

... ALMATY CITY . ... EXCURSIONS . ... XIV International Ornithological Conference of North Eurasia . Almaty, 18–24 August 2015) . ... ONE-DAY FIELD EXCURSIONS AFTER THE CONFERENCE . ... Northward from the city there is a semidesert area with such water bodies as Kapchagay water reservoir on the Ili River (70 kms N from Almaty), and Sorbulak, which is a sewage pond (located 80 kms NW from Almaty). ... 2) Excursion to Lake Sorbulak in the semidesert zone . ...

Еще в разделе: (Показать все результаты (>5248) - zmmu.msu.ru/ )

• Russian Journal of Theriology
• Vocal activity and acoustic structure of the rutting calls of Siberian wapiti
• Coastal and island theriofauna of the eastern part of the Gulf of Finland

О факультете . ... Социологические школы и олимпиады . ... Вестник МГУ . ... МГУ, д. 1. стр. ... English version . ... Programs for foreign students . ... Contacts Faculty of Sociology was founded on June 6, 1989. ... Hence the faculty offers the best educational programs to meet the needs of international students and requirements of contemporary sociology and employment standards in today?s dynamic and changing world. ... PhD programs The faculty provides studies for bachelor's degree in Sociology. ...

Еще в разделе: (Показать все результаты (>34) - www.socio.msu.ru/ )

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>14) - ecoinformatica.srcc.msu.ru/ )

Marketing Plan Outline Canada Business Service Centres - CBSCs Last Verified: 2004-11-08 Document No. 4014 Summary A marketing plan is designed to direct company activities towards the satisfaction of customer needs; determine what the customer wants, develop a product/service to meet those needs, get the product/service to the end user and communicate with the customer - at a profit! ... levels, sales volumes? ... What is the consumer acceptance price range for this type of product/service? ...

Еще в разделе: (Показать все результаты (>24) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/settingupapaysystem.doc
• http://www.innovation.msu.ru/english/reportofinvention.doc
• http://www.innovation.msu.ru/english/pointstoconsider.doc

. Scobeltsyn Institute of Nuclear Physics , . Moscow State University , . Experimental High Energy Physics Department . RU-119899, Moscow, Russia . Phone (work) :(+7)(095)939-5881 . Fax :(+7)(095)939-3064 . E-mail : dudko@lev.art.ru . (.ps.gz) . (.ps.gz) , pdf . (.ps.gz) , pdf .

Еще в разделе: (Показать все результаты (>11) - top.sinp.msu.ru/ )

... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... Modi?ed KLYPVE is a novel ?uorescence detector of ultra high energy cosmic rays (UHECRs, energies 50EeV) to be installed on the Russian Segment of the International Space Station. ... The main component of KLYPVE is a segmented two component optical system with a large entrance pupil and a wide ?eld of view, which provides annual exposure approximately twice that of the Pierre Auger Observatory. ...

Еще в разделе: (Показать все результаты (>46) - uhecr.sinp.msu.ru/ )

• Ultra High Energy Cosmic Rays and Neutrinos
• High energy electromagnetic cascades in extragalactic space: physics and
• Publications UHECR