... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>17) - mouse.belozersky.msu.ru/ )

• Example of alignment
• Alignment example
• 1QPI biounits

... Inhibitory effect of palmitate on the mitochondrial NADH:ubiquinone oxidoreductase (complex I) as related to the active-de-active enzyme transition. ... Taken together, these results suggest that free fatty acids act as specific complex I-directed inhibitors; at a physiologically relevant temperature (37 degrees C), their inhibitory effects on mitochondrial NADH oxidation is due to perturbation of the pseudo-reversible active-de-active complex I transition. ...

Еще в разделе: (Показать все результаты (>92) - biochem.bio.msu.ru/ )

• Effect of disulfide crosslinking on thermal transitions and chaperone-like
• Cardioprotective effect of histidine-containing dipeptides in pharmacological
• Effect of homocysteine and homocysteic acid on glutamate receptors on rat

... 13, Moscow 119992, Russian Federation, e-mail: busarev@sai.msu.ru; 2 Research Institute Crimean Astrophysical Observatory, p/o Nauchnyi, Crimea 334413, Ukraine, e-mail: prok@crao.crimea.ua Summary: We propose a combined method of astronomical investigations of small or distant planets incorporating registration of a set of integral spectra of an object and their frequency analysis. ... An application of the method is shown on example of asteroid 21 Lutetia. ... 6] Busarev V. V. (2002), Solar Sys. ...

Еще в разделе: (Показать все результаты (>98) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Shev/Publications/m44_76_sinitsin_shevchenko.pdf
• http://selena.sai.msu.ru/Bus/Publications/UFN2007(Bus_etal)(engl).PDF
• http://selena.sai.msu.ru/Shev/Publications/ms34/MS064.pdf

... Выпускники . ... Женский клуб . ... Издательство МГУ . ... Выпускники МГУ . ... Исследователи из Университета Альберты в Эдмонтоне, Канада, вылечили рак, но в новостях и на телевидении это почти не было освещено. ... В методе используется дихлорацетат (dichloroacetate), который в настоящее время применяется для лечения нарушений обмена веществ. ... Канадские ученые проверили дихлорацетат на клетках человека; препарат убил раковые клетки легких, молочной железы и мозга, но не затронул здоровые. ...

Еще в разделе: (Показать все результаты (>328) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: The Blood Test Gets a Makeover
• Клуб выпускников МГУ: Ученые обнаружили генетические корни интеллектуального

... Statistics One, Lecture 3, example script # Read data, plots histograms, get descriptives library("psych") ratings . Statistics One, Assignment One Statistics 1, Assignment 2 . ... Дайджест психологических исследований . ЖЖ-сообщество ?RU_SPSS? ... Сервер виртуальных исследований . Скачать SPSS . Статистика блога . ... R-советы: Экономим время и место на диске путем сжатия файла данных . ... Yurij Tukachev on Twitter Counter Вам нравятся материалы блога? ...

Еще в разделе: (Показать все результаты (>20) - tukachev.flogiston.ru/ )

• Category: Новости

MAGNETOHYDRODYNAMICAL ANALOGY AND SEISMOELECTRICAL EFFECT Natyaganov V.L., Chaika A.A., Chistyakova A.A. (Moscow) The work is offered with the physics and mathematics model of seismoelectrical effect on basis of magnetohydrodynamical analogy of the theory of airplane wing motion. ... 10, 2002, .355-357 , , . ... 1) 1966 . ... 1946 .) ... r div v = 0 r rot v = 0 C (1) rr rot v = C r r r : v v 0 : {v n } C = 0 : r div H = 0 r rot H = 0 C r rot H = r C j r r r : H H 0 ; {H n } C = 0 (2) , n ­ C «» . ...

Еще в разделе: (Показать все результаты (>195) - www.mce.biophys.msu.ru/ )

• Books : After Effects 5.5: революция качества цифрового видео
• Protecting effect of epibrassinolid on blood-brain barriers' penetration of
• Modeling of the processes connected to nucleon cluster effects

Judging the pedogenic development of soils and paleosols seems simple until more than three kinds of soils are considered. ... SD is commonly described as weak, moderate or strong (or poor, moderate or well), a 3-class system that can be modified with adjectives. ... A scale for ranking soil and paleosol development. ... An effective paleosol classification requires delineation of those key attributes in modern soils with a moderate to high preservation potential following burial and diagenesis. ...

Еще в разделе: (Показать все результаты (>157) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Order images - Posters
• REPORT ON INTERNATIONAL SOIL SCIENCE CONGRESS (Montpellier, France, August...
• SPECIAL ISSUE OF CATENA «RECONSTRUCTION AND CLIMATIC IMPLICATIONS OF PALEOSOLS»

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes
• ConClus
• Nhunt: program for nucleic acid sequence similarity search

... 350, No. 7, 1996, pp. ... OCEANOLOGY Application of a Double-Flash, Impulse, Submersible Fluorimeter in the Determination of Photosynthetic Activity of Natural Phytoplankton D. N. Matorin, P. S. Venediktov, Yu. ... The intensity of fluorescence is used in oceanology as an indicator of chlorophyll concentration in reservoirs [8]. Photosynthetic activity may be evaluated by means of measuring the intensity of variable fluorescence dependent on PS2 [1, 4, 5, 7, 10]. ... Biofiz., 1990, vol. 40, pp. ...

Еще в разделе: (Показать все результаты (>36) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3345.pdf
• http://library.biophys.msu.ru/PDF/3340.pdf
• http://library.biophys.msu.ru/matorin/3393.pdf

TB, SH, US, JPhysG/276799, 10/07/2008 IOP PUBLISHING J. Phys. G: Nucl. ... The ring-like and jet-like structures in two-dimensional angular histograms are well extracted by wavelet analysis both for toy models and in Monte Carlo simulated events of nucleus­nucleus collisions at LHC energies. ... We answer these questions by showing that the method of the wavelet analysis allows us to distinguish jets from rings and to find jet positions among the underlying backgrounds in Monte Carlo simulated events. ...

Еще в разделе: (Показать все результаты (>57) - lav01.sinp.msu.ru/ )

• History of Strong Interactions Laboratory

. SDPpred: a tool for prediction of amino acid residues . that determine differences in functional specificity of homologous proteins .

Еще в разделе: (Показать все результаты (>61) - monkey.belozersky.msu.ru/ )

• Example of supporting positions
• SDPpred
• 1FJL biounits

A.N. Belozersky Institute . Bioinformatics Portal . ... Russian EMBnet Node . ... AliBee - Multiple alignment Release 2.0 . ... Grants information . ... Our Institute is a scientific department of Moscow State University. ... Address: Belozersky Institute,Moscow State University,Leninskie Gory 1,Bldg. ... Information about our activities and EMBnet resources around the World is available here . Information about our educational activities with kids, children and teenagers is available here . ...

Еще в разделе: (Показать все результаты (>163) - www.genebee.msu.ru/ )

• Bioinformatics portal, Moscow State University
• GeneBee service
• RNA secondary structure prediction

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>161) - www.pereplet.ru/ )

... H: · 1 ­ Al2O3­Na3AlF6 (T - x) = 1 , ­ , ­ 1 ( ­ ); · 1 ­ Na2SO4­H2O (T - x) = 1 ( ); · 25° ( .. ... Na2SO4­H2O Na2SO4 10H2O, Na2SO4 + 10H2O Na2SO4 10H2O. , , , . ... 6, 7) LiBr KBr, , : L LiBr() + KBr() . ... 1) , , KBr. ... L. PbTe­SnTe PbSe­SnSe PbTe PbSe, , (.. ... BeF2­LiF , ( ), LiBeF3 Li2BeF4 BeF2­LiF (. ... LiBeF3 280°, BeF2 Li2BeF4 : LiBeF3 () ­ Na2SO4 7H2O: Na2SO4 + 7H2O Na2SO4 7H2O. : Na2SO4 7H2O() Na2SO4 10H2O() Na2SO4 () Na2SO4 () +L 24° BeF2 () + Li2BeF4 () . ... Na2SO4­H2O Na2SO4­H2O....

Еще в разделе: (Показать все результаты (>45) - www.inorg.chem.msu.ru/ )

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>179) - elana.sinp.msu.ru/ )

• cheap north face How to Spot Counterfeit Tommy Hilfiger | С Днем Победы!
• contro la legge.- non ha niente che comprendono l?originale e non durature | С
• michael kors outlet uk which is accessible via the Internet as a Web server.

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... Unless in many other approaches to the analysis of different signal coupling, the information entering the analysis of synchronization in our approach is explicitly represented in the form of elementary, instantaneous events (the change-points). ... Hence the use of correlation/coherency estimates in parallel with change-point analysis seems to be quite rational. ...

Еще в разделе: (Показать все результаты (>61) - brain.bio.msu.ru/ )

• Change-points in EEG components with different pattern
• Change-points at different levels of the hierarchy of EEG segmental...

Femtosecond Time-Resolved Transverse Kerr Effect Measurements in Magnetoplasmonic Crystals A. Yu. ... Application of external magnetic field to a magnetic medium causes alteration of reflected light amplitude that is so-called magneto-optical Kerr effect. ... For example, excitation of surface plasmon polaritons (SPP) in a magnetized sample by femtosecond laser pulses can lead to time moduation of magneto-optical transversal Kerr effect (TKE) intensity that differs from its steady-state value. ...

Еще в разделе: (Показать все результаты (>83) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/iconolat.pdf
• http://nanolab.phys.msu.ru/sites/default/files/gulkin_dd15.pdf
• http://nanolab.phys.msu.ru/sites/default/files/bras43.pdf