... Институт . ... Студентам . Приветствуем вас на Официальном сайте Русско-германского института науки и культуры. Published by admin on April 6, 2016 under Новости . ... No Comments ? ... 09.00 - 15.30 љ љљ 736 - 1.ГУМ . ... Морозова Е.Б. пн. љ17-00? 18-30, 18-45?20-15, 20-30?21-15љ 1 к., ауд.736 1 ГУМ . ... Башкиров В. М. вторник 15.00-17.00, четверг љ15.00-17.00, 1 ГУМ ауд.736 . вторник 17.00-19.00, пятница 17.00-19.00 1 ГУМ ауд.736 . ... 736 1 Гум) . ... 7361 Гум) . ... December 2011 . ...

Еще в разделе: (Показать все результаты (>2) - rgi.msu.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>354) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>394) - monkey.belozersky.msu.ru/ )

• SVETKA, a program for multiple sequence alignments analysus
• SVETKA, a program for multiple sequence alignments analysis
• Homeodomain numeration assumed

. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>3) - www.dubinushka.ru/ )

All your comments please send to Yagola Anatoly ( yagola@prof.msu.ru ) or to web-deseigners of the site ( ill-posed@mail.ru , nataschka_@mail.ru ).

Еще в разделе: (Показать все результаты (>29) - foroff.phys.msu.ru/ )

• Admission Regulation

Dear Sergey Shakin: Per mit me to comment on the accusations br ought against Academician Nekipelov, which I read on the site of Polit.ru. In the first place, it is clear that the editors, having r equested an "academic" r eview of the Nekipelov book, have stretched and abused the comments by Professor Sonin. ... The other matters -- for instance whether ther e is too much citation for a monograph -- are entir ely subjective, matters basically of academic taste. ...

Еще в разделе: (Показать все результаты (>16) - www.mse-msu.ru/ )

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>426) - www.rochesterastronomy.org/ )

• Supernova 1999an in IC 755

The Fulbright Program in Russia . ... The Bureau of Educational and Cultural Affairs (ECA) of the United States Department of State is pleased to announce a new International Fulbright Science and Technology Award for outstanding foreign students. The award is designed to be among the most prestigious international scholarships in science and technology. The International Fulbright Science and Technology award is for PhD study at top U.S. institutions in science, technology, or engineering. ...

Еще в разделе: (Показать все результаты (>58) - www.prof.msu.ru/ )

• Institute of Civilization

... A.V.Burlakov, M.V.Chekhova, O.V.Karabutova, D.Yu.Korystov, Yu.B.Mamaeva and S.P.Kulik, Interference of Biphoton Fields. Laser Physics (2001) - в печати. ... Phys.Rev.A, 64, 041803 (4 стр) 2001. ... 2001). ... 86, ?20, 4710 (2001). ... Д.Ю.Кoрыстов, С.П.Кулик, А.Н.Пенин. ... Письма в ЖЭТФ 73, 248-252 (2001). ... A.V.Burlakov, M.V.Chekhova, D.N.Klyshko, S.P.Kulik, A.N.Penin, D.V.Strekalov and Y.H.Shih, Interference Effects in Spontaneous Two-photon Parametric Scattering from Two Macroscopic Regions. ...

Еще в разделе: (Показать все результаты (>66) - qi.phys.msu.ru/ )

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>93) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>200) - www.philol.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>168) - mccmb.belozersky.msu.ru/ )

• MCCMB'15 - OpenConf Peer Review & Conference Management System

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...

Еще в разделе: (Показать все результаты (>4) - swx.sinp.msu.ru/ )

... Annex (e.g. 3.1) (3) Paragraph/ Figure/Table/ Note (e.g. Table 1) 4 Type of comment2 5 Comment (justification for change) by the MB Date: (6) Document: (7) Secretariat observations on each comment submitted Proposed change by the MB RU RU RU RU 2 2 2 2 Row 2 Row 4 Row 4 Row 5 ed ed ed te SEPs are not fluxes , but particles It is desirable to add that Wolf number is also known as the sunspot number. ... CLOSED: Accepted and implemented in modified form CLOSED: Accepted and RU 2 Row 16 . ...

Еще в разделе: (Показать все результаты (>9) - srd.sinp.msu.ru/ )

• http://srd.sinp.msu.ru/nymmik/models/quaghebeur_2.pdf
• http://srd.sinp.msu.ru/nymmik/models/quaghebeur_1.pdf

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

78. MMOnline | Форумы | Преподаватели | А.Т. Фоменко

79. VaST homepage