... Recently Professor Bagotsky summarized his uniquely long scientific work in a brief article "Fuel Cells, Batteries, and the Development of Electrochemistry" published in the "Electrochemistry ­ Past, Present, and Future" issue of J. Solid State Electrochemistry(Vol.15,p.1559,2011).Hementionedthatbecause he was working simultaneously in the fields of fundamental and applied electrochemistry, he had the opportunity to experience the mutual influence in the development of these two fields. ...

Еще в разделе: (Показать все результаты (>58) - electr003.chem.msu.ru/ )

• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>106) - uneex.mithril.cs.msu.su/ )

• LecturesCMC/UnixFirewalls2014/07_UsingIPTables - UNИX
• PspoClasses/080708/01IptablesTheory - UNИX

... Статус проекта: Инициативный проект Д. А. Симонова. На кафедре динамической геологии принят в качестве базового при преподавании обязательного учебного курса "Применение геоинформационных систем при геологических исследованиях". ... Целью проекта является , наряду с обучением студентов основам применения и использования геоинформационных систем , создать пакет интерактивных карт для Восточно-Европейской платформы, применимых как в образовании так и в различных областях геологической науки. ...

Еще в разделе: (Показать все результаты (>20) - dynamo.geol.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>184) - www.fadr.msu.ru/ )

• "EcoPhoto" - Order photo - CD
• Contens
• THE ALBANIAN AGRICULTURAL SECTOR IN TRANSITION

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>11) - www.issp.ac.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>274) - www.philol.msu.ru/ )

... Professor Yurii Naumovich Lipsky oversaw the preparation of the first ever maps of the far side of the Moon, of the whole Moon, and cartographic globes of the Moon. ... He was a professor, a doctor of physico-mathematical sciences, the founder of the Department of Lunar and Planetary Physics in GAISh and its first head. ... The first photographs of the far side of the Moon . ... He was the scientific supervisor of the study of the first photographs of the far side of the Moon. ...

Еще в разделе: (Показать все результаты (>72) - selena.sai.msu.ru/ )

• Works of the Department of lunar and planetary research of GAISh MGU

... About CIE MSU . ... Useful Information . ... Vestnik CIE (in Russian) . ... Moskva, IPA: [m? skva]) the capital of Russia and the country s principal political, economic, financial, educational, and transportation center, located on the Moskva River. the city s population of 10.4 million permanent inhabitants within the city boundaries constitutes about 7% of the total Russian population. ... Moscow s road system is centered roughly around the seat of the Russian government, the Moscow Kremlin. ...

Еще в разделе: (Показать все результаты (>17) - www.cie.ru/ )

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>95) - srcc.msu.ru/ )

• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>95) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design. Part 4

... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>6396) - www.mmonline.ru/ )

• MMOnline | Новости | ММПриколы. Часть 3
• ММПриколы. Часть 3
• MMOnline | Форумы | Первокурсникам | Си - полезная информация

. This is the default web page for this server. The web server software is running but no content has been added, yet.

74. http://shamolin2.imec.msu.ru/art-136-1.pdf

75. Travel information. 14 European Symposium on Gas Phase Electron Diffraction

76. Хоккей ЧМ 2008 - Public forum of MSU united student networks

77. Firefly DOCUMENTATION - command line arguments

78. http://tunka.sinp.msu.ru/en/presentation/Shpiering.pdf

79. INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS

80. RNA Kinetics: Theory