... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>6) - www.issp.ac.ru/ )

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>56) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>49) - classic.chem.msu.su/ )

• Firefly/PC GAMESS standard MCQDPT2 benchmark results on modern hardware
• Firefly/PC GAMESS standard MP4 benchmark results on modern hardware
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2

... Seminar archive . ... Seminar archive 2012 22 June . ... Гнедин О. Ю. Numerical simulations of galaxy formation, based on the cold dark matter model, explain the observed large-scale structure and abundance of massive galaxies. ... Many more dwarf galaxies around large galaxies are predicted than observed, leading to the "missing satellites problem". Much more cosmic gas inside galaxy halos is predicted than observed, leading to the "missing baryons problem". ... All seminars: . ...

Еще в разделе: (Показать все результаты (>27) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory

... Introduction W hat is Time? W hy does Universe expand during Time? ... The prof. Kozyrev's time representation: time "transforms" into energy. ... Note, BH's are the objects having maxi mal entropy, because of that the maxi mum of their creation corresponds to a maximal rate of the Universe entropy increasing . ... The mass of each object (like all the Universe mass) increases linearly with time, so Kozyrev's idea that "time transforms to the energy" turns out surprisingly true. ...

Еще в разделе: (Показать все результаты (>321) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/sarli_temporal.pdf
• Table 1
• The Finite and the Infinite: A New view on the problem

Backlinks to TemplateTopics in all Webs ( Search System Web only ) . ... Related topics: CommentPluginTemplates, .CommentPluginExamples .. NEW - 10 Apr 2011 - 18:03 by ProjectContributor . ... NEW - 03 Aug 2010 - 16:42 by ProjectContributor . ... Developer Documentation Application Developer Topics Topics for normal users that want to develop Foswiki applications. ... NEW - 03 Sep 2010 - 08:51 by ProjectContributor . ... NEW - 05 Nov 2010 - 13:09 by ProjectContributor . ... Number of topics: 26 . ...

Еще в разделе: (Показать все результаты (>1864) - wiki.cs.msu.ru/ )

• (backlinks in System Web) TemplateTopics < System < Foswiki
• (backlinks in System Web) ChangeEmailAddress < System < Foswiki
• (backlinks in all Webs) ChangeEmailAddress < System < Foswiki

Microsymposium 34, MS015, 2001 TO THE DISCOVERY OF THE "SOUTH POLE - AITKEN " BASIN. ... Head [2] and Spudis [1] suggested in their reviews that the existense of the structure identified later as the South Pole - Aitken baasin was first predicted on the basis of a relief analysis of the mountain ridges observed in the libration zone be Hartman and Kuiper [7], i.e. after the first images of the lunar far-side had been obtained. ... SOUTH POLE-AIKEN BASIN: V.I.Chikmachev et al. ...

Еще в разделе: (Показать все результаты (>73) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Symposium/South%20Pole.doc
• http://selena.sai.msu.ru/Symposium/South%20Pole.pdf
• Yurii Naumovich Lipsky

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... РЕФЕРАТЫ СТАТЕЙ ПО РУКОКРЫЛЫМ / ABSTRACTS OF BAT ARTICLES . Глобальная оценка полноты ископаемых остатков рукокрылых / Global completeness of the bat fossil record: - Eiting, T.P., Gunnell, G.F., Journal of Mammalian Evolution, 16(3): 151-173, 2009. ... Measures of completeness of the fossil record have important consequences for our understanding of evolutionary rates and patterns among bats. ... At the genus level, the bat fossil record is estimated to be 12% complete. ...

Еще в разделе: (Показать все результаты (>1197) - zmmu.msu.ru/ )

• Order Chiroptera
• A preliminary study on genetic divergence of the Asian lesser white-toothed
• Bat specialists

. Источники: . 226 Ra . Неизвестные . 1 . 2 . 3 . 4 . Масшаб по Y: . 32 64 128 256 512 1024 2048 4096 8192 16384 32768 65536 . Время измерения . 1 2 3 4 5 6 7 8 9 10 50 100 сек . alt=" Your browser understands the APPLET> tag but isn't running the applet, for some reason." Your browser is completely ignoring the APPLET> tag!

Еще в разделе: (Показать все результаты (>137) - nuclphys.sinp.msu.ru/ )

• Определение расстояния между источником и детектором
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• Определение толщины пластин

... Полная версия этой страницы: черные дыры в новостях . Студенческий форум Физфака МГУ > Наука физика > Интересные задачи и познавательные вопросы . ... 9.1.2009, 15:49 . ... http://www.newsru.com/world/09jan2009/black.html . ... В целом это правда, что галактики образовались именно вокруг черных дыр (точнее сказать, сверхмассивные черные дыры принимают непосредственное участие). ... Понятно, что происхождение галактик и сверхмассивных черных дыр в них должно быть связано. ...

Еще в разделе: (Показать все результаты (>285) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Ссылки на интернет-ресурсы по физике
• Студенческий форум Физфака МГУ > PhD in Astrophysical Sciences, Princeton, USA
• Студенческий форум Физфака МГУ > Прием в аспирантуру Принстонского Университета

... Symmetry in Bubble Dynamics . ... An investigation on novel lines is made into the problem of nonlinear bubble dynamics. ... The complete symmetry groups are found for the Rayleigh equation. ... The possible application of the scaling law dynamics to the problem of stable single bubble sonoluminescence is discussed. Conformal symmetry of Laplace equation provides an approach for finding exact solutions for the pulsation of gas bubble tethered to a rigid wall. ...

Еще в разделе: (Показать все результаты (>65) - acs366.phys.msu.su/ )

• General Information

... Earlier still lies the remaining frontier, where the first stars, galaxies and massive black holes formed. ... Building on this general framework, and relying on the development of efficient new computational tools, the fragmentation properties of primordial gas inside such minihaloes were investigated with numerical simulations, leading to the result that the first stars, so-called population III, were predominantly very massive4,8 (see Box 1 for the terminology used here). ... Astrophys. ... III. ...

Еще в разделе: (Показать все результаты (>13) - ocean.phys.msu.ru/ )

... О кафедре . ... Сотрудники . ... Соколов Дмитрий Дмитриевич, родился в 1949 г., поступил на Физфак МГУ в 1966 г., с 1972 г. - на кафедре математики, сначала аспирант, а потом, постепенно, стал профессором, доктором физ.-мат. наук. ... Magnetic fields as a unique tracer of shearing gas flow in a barred galaxy", Beck R., Ehle M., Shoutenkov V., Shukurov A., Sokoloff D., Nature, 397, (1999), 324. ... Семинар кафедры . ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>6) - matematika.phys.msu.ru/ )

... List of solitary restriction endonucleases in complete prokaryotic genomes . List of groups of orthologous R-M systems. List of all analyzed genomes. Contains those orthologous groups that include at least one separated R-M system . R-M orthologous group ID . REs alignments . MTases alignment . Group 1 . ...

Еще в разделе: (Показать все результаты (>5) - mouse.belozersky.msu.ru/ )

• wLake algorithm description