Diploma thesis abstract" The experimental investigation of hypersound originated by stimulated Brillouin Scattering process. ... The intensity of scattered beam was detected as a function of the coordinate z along the pumping laser beam direction, which permitted us to detect the intensity of HS as a function of z. The measurements was fulfilled for the different intensities of pump laser beam and for two different focuses lens. ...

Еще в разделе: (Показать все результаты (>27) - ofvp.phys.msu.ru/ )

... Grant of Ministry of Science and Techologies of Russian Federation, subprogram "Engineering enzymology . ... The development of fundamentals and technology of sulfur removal from gas and waste water streams by immobilyzed biocatalytic systems . ... Grant of Ministry of Science and Technologies of Russian Federation subprogram "Biocatalytic technologies " . Ministry of Science and Technologies of Russian Federation . ... Grant of Ministry of Science and Technologies of Russian Federation . ...

Еще в разделе: (Показать все результаты (>66) - www.enzyme.chem.msu.ru/ )

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Alexander Valeryevich POZDNEEV (November 22, 1983, Novosibirsk, Russia) тАФ teaching assistant (assistant professor). Graduated with honours from the Faculty of Computational Mathematics and Cybernetics (CMC) at Lomonosov Moscow State University (MSU) (2006). Succesfully completed postgraduate study at the Faculty of CMC at Lomonosov MSU (2009). ... A.V. Pozdneev. ...

Еще в разделе: (Показать все результаты (>4) - ani.cmc.msu.ru/ )

• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific

... Shown that this calculation method may be applied for optimal completed of the laser cavities by the mirrors. ... 4]. , ( ) - sin j co s j Mj = pj (1 ) , - p sin co s j j j sin 2 1 1- j = arccos 2 2 nj , n j h j cos j , p j = n j cos j , j = 1- , - . ... rTE rTM . ... R = r r* ; TE TE TE : rTE = arctg Im rTE Re rTE rTM = arctg , Im rTM Re rTM - : : 0 rTM expi 2 Z= 0 - rTE exp - i 2 . ... M cw M ccw : M ccw =M cw cos( = si n ( ) ) - sin ( ) = S ( ) , cos( ) - . ... 11° L16. , (6). 10q 01(q+1), . ...

Еще в разделе: (Показать все результаты (>117) - nuclphys.sinp.msu.ru/ )

• Альфа-распад (измерения)
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• Определение расстояния между источником и детектором

I was born on July, 8, 1988 in Perm, Russia. ... June 2004 . ... September 2004 . till July 2009 . student of Perm State University, Faculty of Physics. Speciality: Condensed Matter Physics. 2006 . ... specialization and practice on Chair of Physics of Phase Transitions. July 2009 . graduated from Perm State University, specialist in Condensed Matter Physics. ... PhD-student in Lomonosov Moscow State University, Faculty of Physics, Chair of Polymer and Crystal Physics. ...

Еще в разделе: (Показать все результаты (>50) - polly.phys.msu.ru/ )

... 125009, Russian Federation, Moscow, MSU, 11 Mohovaya St., Institute of Asian and African studies . ... The history of studying languages and Oriental cultures in Moscow State University (MSU) started in the fifties of the 18th century. ... Students are welcome to deepen their knowledge in Philology, History, Economics of Asian and African countries at study programs of our Institute and receive MAљ . The IAAS MSU has several master degree programs (course "Asian and African Studies"): . ...

Еще в разделе: (Показать все результаты (>58) - www.msu.ru/ )

• FACULTY OF PSYCHOLOGY
• Faculty of Public Administration
• Moscow Summer Academy on Economic Growth and Governance of Natural Resources

... Copyright © 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>206) - itpm.msu.su/ )

• Kernel Options in 1.0 and Higher
• Module Index - Apache HTTP Server
• Using NIS with Shadow Support

... Полная версия этой страницы: Ph.D. in Large Lakes Observatory (University of Minnesota) . Студенческий форум Физфака МГУ > Физфак и учеба > Аспирантура . ...

Еще в разделе: (Показать все результаты (>247) - wasp.phys.msu.ru/ )

• Ph.D. in Large Lakes Observatory (University of Minnesota) - Студенческий форум
• Студенческий форум Физфака МГУ > PhD in Astrophysical Sciences, Princeton, USA
• Студенческий форум Физфака МГУ > Прием в аспирантуру Принстонского Университета

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>30) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Правила

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>91) - uneex.mithril.cs.msu.su/ )

• LecturesCMC/UnixFirewalls2014/07_UsingIPTables - UNИX
• PspoClasses/080708/01IptablesTheory - UNИX

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>115) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

День Физика . ... Новости . ... Абитуриентам . ... Главная Новости Наука . ... Новости сайта . ...

Еще в разделе: (Показать все результаты (>2) - www.dubinushka.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>151) - www.philol.msu.ru/ )

... There is no trigger -- channels are sampled continuously and written first to disk, later to tape Total data rate from each interferometer: ~3 MB/sec Gravitational wave channel is only ~2% of the data stream Data to be archived: ~100-200 TB per year ACAT 2002 Peter Shawhan ( LIGO / Caltech ) Gravitational-Wave Data Analysis Different scientific topics require different ...

Еще в разделе: (Показать все результаты (>37) - acat02.sinp.msu.ru/ )

... Field of research: Extragalactic astronomy. ... NASA Astrophysics Data System (ADS) Abstract Service . ... CADC Home Page . ... CCD Images of Galaxies . ... RUSSIAN LINKS . ... UA Astronomy Personal Home Page - Bill Keel . ... The Shape of the Rotation Curves of Edge-on Galaxies, by A.V.Zasov and A.V.Khoperskov, 2003. ... A Thickness of Stellar Discs, by A.V.Zasov, and D.V.Bizyaev, 2003 . Minimum Velocity Dispersion in Stable Stellar Disks, by A.V.Khoperskov, A.V.Zasov, and N.V.Tyurina, 2003 . ...

Еще в разделе: (Показать все результаты (>55) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules
• Apache modules
• Apache module mod_dir

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>108) - www.fadr.msu.ru/ )

• Фотоархив "EcoPhoto" - Заказ фото - CD
• "EcoPhoto" - Order photo - CD
• Online Registration

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>27) - srcc.msu.ru/ )

• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

... Recently Professor Bagotsky summarized his uniquely long scientific work in a brief article "Fuel Cells, Batteries, and the Development of Electrochemistry" published in the "Electrochemistry ­ Past, Present, and Future" issue of J. Solid State Electrochemistry(Vol.15,p.1559,2011).Hementionedthatbecause he was working simultaneously in the fields of fundamental and applied electrochemistry, he had the opportunity to experience the mutual influence in the development of these two fields. ...

Еще в разделе: (Показать все результаты (>39) - electr003.chem.msu.ru/ )

• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage
• Pronkin Sergey Nikolayevich

... Changed: . ... TWikiUsersGuide - complete TWiki documentation, Quick Start to Reference . ... You can customize preferences settings to your needs: To overload a system setting, (1) do a "raw view" on TWikiPreferences , (2) copy a Set VARIABLE = value bullet, (3) do a "raw edit" of your user homepage, (4) add the bullet to the bullet list above, and (5) customize the value as needed. ... TWikiUsers has a list of other TWiki users . UserDocumentationCategory is a list of TWiki user documentation . ...

Еще в разделе: (Показать все результаты (>32309) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (15 vs. 19) - TWiki
• VarSEARCH - TWiki - TWiki
• VarSEARCH - TWiki - TWiki - (printable)