... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>110) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

i 1 Summar y of 3 P3 "Simulations and Computations in Theoretical Physics and Phenomenology": -- Automated Calculation and Simulation Systems -- Thorsten Ohl и -- Universitat Wurzburg -- и ohl@physik.uni-wuerzburg.de ACAT 2002, Moscow State University, June 28, 2002 Th. ... Status and Trends at ACAT 2002 . ... Ohl Automatic Calculation Systems ACAT 2002 Mission Fully automated calculation and simulation systems in par ticle physics aim to produce model parameters process e. g. cuts L m, g, . ...

Еще в разделе: (Показать все результаты (>55) - acat02.sinp.msu.ru/ )

... Scanning Probe Microscopy Image Processing Software User's Manual '' FemtoScan ``. Version 4.8 - A.S. Filonov, D. Yu. ... The Manual contains detailed description of '' FemtoScan `` software for scanning probe microscope (SPM) control and image processing. ... In the beginning of this manual description of '' FemtoScan `` scanning probe microscope construction and principles of SPM image processing can be found. ... Image formation and processing methods . ... Image Processing . ...

Еще в разделе: (Показать все результаты (>73) - www.spm.genebee.msu.ru/ )

• Temperature calibration file format
• Femtoscan SPM

... DESCRIPTION General Catalog of Variable Stars (GCVS database) . ... Kholopov P.N., Samus N.N., Durlevich O.V., Kazarovets E.V., Kireeva N.N., Tsvetkova T.M., 1990, General Catalogue of Variable Stars, 4rd ed., vol.IV, Nauka, Moscow. Kholopov P.N., Samus N.N., Durlevich O.V., Kazarovets E.V., Kireeva N.N., Tsvetkova T.M., 1992, General Catalogue of Variable Stars, 4rd ed., vol.IV, Bull. ... Kazarovets E.V., Durlevich O.V. Editor-in-Chief Samus N.N., 1998, New Catalogue of Suspected Variable Stars. ...

Еще в разделе: (Показать все результаты (>83) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Vols I-III (the new electronic version).
• General Catalogue of Variable Stars: Homepage.

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>84) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Правила

My colleagues and I have recently completed a series of observations of SN1999an. ... The telescope is located at Martin Observatory in Blacksburg, VA, and is operated by the Physics Department of Virginia Tech. Our IAU Minor Planet Center Observatory Code is 841. ... Attached you will find a copy of one of our images (in .jpg format) with the supernova indicated. ... Virginia Tech Department of Physics . Back to Bright Supernovae . Back to Supernova 1999an . ...

Еще в разделе: (Показать все результаты (>6) - www.rochesterastronomy.org/ )

LangueDOC . ... Texts . ... Apply the program BoxReader to transform the Toolbox document into an XHTML formtat that uses nested tags to represent structure. ... Apply an XSLT stylesheet to transform the XHTML file into the content.xml of the OpenOffice format. ... Add the resulting content.xml into a complete OpenOffice text document replacing the old content.xml . ... Apply the converse XSLT transform to obtain the document in the XHTML nested-span format that can be displayed in the browser . ...

Еще в разделе: (Показать все результаты (>234) - www.philol.msu.ru/ )

• LangueDOC :: Movie
• FDSL-7.5 | Home
• FDSL-7.5 | Call for Papers

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>8) - bioinf.fbb.msu.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>124) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC
• Клуб выпускников МГУ: Внутримышечные инъекции - главная надежда на излечение от
• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс

... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>90) - www.mmonline.ru/ )

• MMOnline | Форумы | Первокурсникам | Си - полезная информация

South Pole - Aitken" Basin on the First Images of the Lunar Far-side V.I.Chikmachev and V.V.Shevchenko Sternberg State Astronomical Institute,Universitetskii pr. ... This is confirmed by the present-day images of the South - Aithen basin floor [see the scheme of the secondary ring structures of the South Pole - Aitken basin (Head, 1993)]. ... Lunar Impact Basins; New Data for the Western Limb and Far -Side (Orientale and South Pole - Aitken Basins) from the First Galileo Flyby, J.Geophys. ...

Еще в разделе: (Показать все результаты (>69) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Symposium/South%20Pole.pdf
• http://selena.sai.msu.ru/Chik/Publications/Aitken/MS015.pdf
• http://selena.sai.msu.ru/Symposium/maps.doc

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>1109) - uneex.mithril.cs.msu.su/ )

• HelpOnProcessingInstructions - UNИX
• Index of /static/DocsKdeOrg_Konqueror/kde3/ru/kdebase/konqueror
• Index of /static/AltDocs_informatika2/Book2/ch_08_math/01_mathematica/03_solve

... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...

Еще в разделе: (Показать все результаты (>28) - smdc.sinp.msu.ru/ )

• Coronas-F - Space monitoring data center

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Laboratory of Liquid Crystals . ... LCOptimizer is a realization of algorithm for calculation of nematic and cholesteric LC structure in PDLC droplets. ... Current version of LCOptimizer software consists of the following units: . ... lcdis3 -- quick change of external field, surface tension or director field distribution in already prepared input file . ... User Manual . User Manual contains general information about the program, input and output description, and some additional tips. ...

Еще в разделе: (Показать все результаты (>108) - polly.phys.msu.ru/ )

• Science
• NATO Scientific & Environmental Affairs
• About me

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>150) - mccmb.belozersky.msu.ru/ )

• MCCMB'15 - OpenConf Peer Review & Conference Management System

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>6) - www.issp.ac.ru/ )

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>32) - erg.biophys.msu.ru/ )

• Quantum chemistry information page ERG Research Group: Лаборатория

NAME dbmmanage - Create and update user authentication files in DBM format SYNOPSIS dbmmanage filename [ command ] [ username [ encpasswd ] ] DESCRIPTION dbmmanage is used to create and update the DBM format files used to store usernames and password for basic authentica- tion of HTTP users. Resources available from the httpd Apache web server can be restricted to just the users listed in the files created by dbmmanage. ... This manual page only lists the command line arguments. ...

Еще в разделе: (Показать все результаты (>77) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules
• Apache Miscellaneous Documentation
• Apache modules