... Symmetry in Bubble Dynamics . ... An investigation on novel lines is made into the problem of nonlinear bubble dynamics. ... The complete symmetry groups are found for the Rayleigh equation. ... The possible application of the scaling law dynamics to the problem of stable single bubble sonoluminescence is discussed. Conformal symmetry of Laplace equation provides an approach for finding exact solutions for the pulsation of gas bubble tethered to a rigid wall. ...

Еще в разделе: (Показать все результаты (>110) - acs366.phys.msu.su/ )

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>7) - theorphys.phys.msu.ru/ )

... New in the group training . Now we have small groups, 3 to 6 students. You will be able to join a group with corresponding level of Russian. ... The 25th of January is a big unofficial holiday for all Tatianas and for all students in Russia.On January, 25 , back in 1755, Russian empress Elizabeth the Great founded the Moscow University.Since that this day has become the most favorite and the merriest holiday of students. (more.. ... Russian proverbs and sayings about Russian language: . ...

Еще в разделе: (Показать все результаты (>5) - www.rlcentre.com/ )

IREX (the International Research and Exchanges Board) is currently accepting applications for American and Russian participants for its U.S.-Russia Volunteer Initiative (USRVI). ... USRVI provides a unique opportunity for young people interested in promotion of Healthy Lifestyles and/or Community Development to volunteer for approximately eight weeks in nongovernmental organizations (NGOs) and/or governmental service centers throughout Russia and the United States. ... Volunteer applicants should: . ...

Еще в разделе: (Показать все результаты (>134) - www.prof.msu.ru/ )

• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS
• Central Eurasian Studies Society Sixth Annual Conference (2005)
• THE ROLE OF THE MASS MEDIA IN THE US FOREIGN POLICYMAKING PROCESS

pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...

Еще в разделе: (Показать все результаты (>5) - dist.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр дистанционного обучения.

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>364) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>5470) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• DNA/RNA-Protein structures
• NPIDB

... Полная версия этой страницы: Аспирантура в США . Студенческий форум Физфака МГУ > Физфак и учеба > Аспирантура . ... Academic requirements will be completed as part of the Applied Mathematics Program. ... Application information is at:http://www.memphis.edu/gradcatalog/d...g/cas/math.php. ... Applications will be considered as they are received, but not later than December 31, 2011. We look especially for prospective PhD students, but applications for Master's level will be considered as well. ...

Еще в разделе: (Показать все результаты (>404) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Работа в Samsung

... A.V.Burlakov, M.V.Chekhova, O.V.Karabutova, D.Yu.Korystov, Yu.B.Mamaeva and S.P.Kulik, Interference of Biphoton Fields. Laser Physics (2001) - в печати. ... Phys.Rev.A, 64, 041803 (4 стр) 2001. ... 2001). ... 86, ?20, 4710 (2001). ... Д.Ю.Кoрыстов, С.П.Кулик, А.Н.Пенин. ... Письма в ЖЭТФ 73, 248-252 (2001). ... A.V.Burlakov, M.V.Chekhova, D.N.Klyshko, S.P.Kulik, A.N.Penin, D.V.Strekalov and Y.H.Shih, Interference Effects in Spontaneous Two-photon Parametric Scattering from Two Macroscopic Regions. ...

Еще в разделе: (Показать все результаты (>88) - qi.phys.msu.ru/ )

... REVIEWS Measurement and Physical Content of Quantum Information B. A. Grishanin and V. N. Zadkov Received January 15, 2002 Abstract--Basic quantum information measures involved in the information analysis of quantum systems are considered. ... But today, it has become possible to intentionally vary directly quantum states of elementary quantum systems. ... 9 2002 MEASUREMENT AND PHYSICAL CONTENT OF QUANTUM INFORMATION 935 its information-equivalent copy is at the input and output. ...

Еще в разделе: (Показать все результаты (>74) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/LasPhys10_03GrishaninLO.pdf
• http://qilab.phys.msu.ru/papers/SPIE-5128-37-46(2003).pdf
• http://qilab.phys.msu.ru/papers/VMU-No.%205,%20pp.%20315-320%20(2008)-EN.pdf

... Security is rarely employed. l Advantages of globus_io ­ Ease of use of security, socket options, QoS ­ Easier Win32 portability ­ Very similar to existing BSD socket calls March 25, 2002 Globus ToolkitTM Developer Tutorial : Communication 2 Approach l l Provide familiar socket and file abstractions Provide both synchronous and asynchronous versions of everything ­ Can easily write code that will not block ...

Еще в разделе: (Показать все результаты (>63) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/news.html
• http://acat02.sinp.msu.ru/InfoBull2.txt
• http://acat02.sinp.msu.ru/presentations/ohl/acat2002.pdf

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>69) - scon155.phys.msu.su/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Listing available drive partitions . ... about partitions. ... Re: Listing available drive partitions [ re: BlackCode ] . ... Re: Listing available drive partitions [ re: l0st ] ...

Еще в разделе: (Показать все результаты (>1125) - www.snto-msu.net/ )

• Персональная информация о available - Public forum of MSU united student
• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student
• Re: Новинки программного обеспечения - Public forum of MSU united student

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>3) - saistud.sai.msu.ru/ )

МГУ имени М.В.Ломоносова Русская версия . ... Public and Municipal Administration . ... Public Relations and Theory of Communication . ... The section "Public Relations and Theory of Communication" based on an educational program "Advertisement and public relations" of Philosophical Faculty of MSU. The research supervisor of an educational program the head of "Philosophy of Language and Communication" department Kostikova A.A., the associate professor , candidate of philosophical sciences. ...

Еще в разделе: (Показать все результаты (>72) - conf.msu.ru/ )

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>13) - www.issp.ac.ru/ )

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

... The Russian Federation Presidential Commission on the modernization and technological development of Russian economy Project "Formation of Highly Qualified Supercomputing Technology and Dedicated Software specialist training system" is now complete. ... Lomonosov Moscow State University, . ... The nationwide system of Research and Education Centers for Supercomputing Technologies (REC SCT), incorporating all Russian Federal Districts, formed the basis for the successful implementation of the project...

Еще в разделе: (Показать все результаты (>31) - hpc.msu.ru/ )

• Nationwide Supercomputing Education Project | Moscow University Supercomputing

... 2012 . ... On November, 15, 2012 E-journal. Public Administration hosted the first workshop for its authors. The workshop was titled Communication management and strategic communication in the contemporary world . ... Public Administration will host such workshops on a regular basis. ... The first presentation was given by Professor Evgeny N. Pashentsev. ... You can read the articles in Communication management and strategic communication in public administration section on our website: . ...

Еще в разделе: (Показать все результаты (>181) - ee-journal.spa.msu.ru/ )