... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>2) - physcontrol.phys.msu.ru/ )

Nhunt: solving the low complexity problem for nucleic acid homology search Yury Pekov1, Kirill Romanenkov2, Alexey Salnikov2, Sergei Spirin 1 3 3 Faculty of Bioengineering and Bioinformatics, 2Faculty of Computational Mathematics and Cybernetics, and Belozersky Institute of Physico-Chemical Biology, Moscow State University. E-mail: sas@belozersky.msu.ru We introduce Nhunt, a program for sensitive nucleic acid homology search. ... The compositional adjustment of amino acid susbstitution matrices. ...

Еще в разделе: (Показать все результаты (>317) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/31.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/138.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/49.pdf

07.02.1953; Penza, Russia Senior Researcher, Laboratory of Physical Chemistry of Polymers, A.N. Nesmeyanov Institute of Organoelement Compounds of the Russian Academy of Sciences, Vavilov St. 28, 119991, Moscow, Russia. Tel: 7(499)135-6457; Fax: 7(499)135-5085; e-mail: burova@ineos.ac.ru . ... 1987 : Visiting scientist at the Central Institute of Genetics of the Academy of Sciences of GDR (Gatersleben, GDR) and at the Central Institute of Nutrition of the Academy of Sciences of GDR (Potsdam, GDR). ...

Еще в разделе: (Показать все результаты (>549) - polly.phys.msu.ru/ )

• History of Research - Chair of Polymer and Crystal Physics
• Personnel - Chair of Polymer and Crystal Physics
• Main - Chair of Polymer and Crystal Physics

... Department of Chemistry, Lomonosov Moscow State University, 1974 . Academic degree . ... D. (Organic Chemistry), 1985 . ... Leading Researcher, Head of Laboratory . ... Department of Chemistry, Lomonosov Moscow State University, Leninskie gory 1/3, Moscow 119991 Russia . ... organic chemistry, medicinal chemistry, chemoinformatics, QSAR, organic synthesis, conformation analysis, computer-aided drug design, molecular modeling, receptors, docking, virtual screening, mathematical chemistry . ...

Еще в разделе: (Показать все результаты (>33) - qsar.chem.msu.ru/ )

• Radchenko, Eugene V. - Laboratory of Medicinal Chemistry
• Karpov, Pavel V. - Laboratory of Medicinal Chemistry
• Voronkov, Andrew E. - Laboratory of Medicinal Chemistry

... Faculty of Physics . ... Online journals . ... Access to the E-library is open from any computer in the intranet of the Faculty connected to the Internet. ... URL link: http://www.iop.org/EJ/ These journals can be accessed on-line from any computer in the intranet connected to the Internet. ... URL link: http://www.elsevier.com/wps/find/journal_browse.cws_home/P12?pseudotype= =Title 1Code=P12 =A These journals can be accessed on-line from any computer in the intranet connected to the Internet. ...

Еще в разделе: (Показать все результаты (>11) - www.phys.msu.ru/ )

• Faculty Staff

. [ Войти ] . Главная -> Пользователи -> gz:researcher . Пользователи . Демо . Деньги . Фильмы . Форум . gz:researcher . Появление: 24.05.2010 14:23:30 . Последнее созидание: 31.12.2009 . Сообщений: 72 . Рейтинг: . 0 0 0 0 .

Еще в разделе: (Показать все результаты (>2027) - kinfo.ru/ )

• Soul Searcher - Фильмы - Kinfo.ru
• Searchers 2.0 - Фильмы - Kinfo.ru
• The Searchers - Фильмы - Kinfo.ru

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Graduated from Moscow State University in 1982 . PhD, Moscow State University, 1987 . Doctor of Science, Moscow State University, 1997 . ... HomePage: http://chaos.phys.msu.ru/loskutov/ . Research Interests . ... Graduated from Moscow State University in 1980 . PhD, Moscow State University, 1984 . Doctor of Science, Moscow State University, 1999 . ... researcher . Ph.D. E-mail: rybalko@polly.phys.msu.ru . ... Homepage: http://polly.phys.msu.ru/~nat_kov/ Research Interests . ...

Еще в разделе: (Показать все результаты (>92) - chaos.phys.msu.ru/ )

• Research interests

... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...

Еще в разделе: (Показать все результаты (>2) - phys.msu.su/ )

... Professional experience . ... Department of Geology. Chair of Dynamic Geology. ... Laboratory of Geodynamic Processes Modeling. ... 2001 Elaboration (together with V.Vadkovsky ) electronic version of textbook on course "Dynamic Processes in Geology" for students of 5th course and postgraduate students (MSU. ... 2000 - Delivering lectures and performing exercises with students on the course "Computer Simulation Of Geodynamic Processes" for students of 3rd course (MSU. ... Page design: їV.Zakharov . ...

Еще в разделе: (Показать все результаты (>31) - dynamo.geol.msu.ru/ )

Laboratories \ Laboratory for ecology of aquatic communities and invasions \ Scientific Staff \ Kotov Alexey: investigations on CLADOCERA . ... CURRICULUM VITAE LIST OF PUBLICATIONS RECENT PROJECTS CLADOCERAN IMAGES . FIRST, MIDDLE, LAST NAME: Alexey Alexeevich KOTOV. ... https://www.researchgate.net/profile/Alexey_Kotov2?ev=hdr_xprf . ... E-MAIL: alexey-a-kotov at yandex.ru . ... Ph.D. by Institute of Ecology and Evolution of Russian Academy of Sciences, 10.03.1998 [Kotov, A. A., 1998. ...

Еще в разделе: (Показать все результаты (>5590) - www.sevin.ru/ )

• Scientific Councils: SCIENTIFIC COUNSIL ON PROBLEMS OF ECOLOGY OF BIOLOGICAL
• Biological Stations: Tver Floating Biological Station: Goals and Tasks
• Экологический Форум - Фундаментальная Экология: Searching For A outlet Way To

. Search Engines . about laboratory | staff | administration | research | education | news | search | links | text only . Copyright 2001, Laboratory of Catalysis and Gas Electrochemistry, Web-design A.N. Kharlanov. If you have any questions or cannot find the information you need, mail to webmaster . Last updated 20 April 2001 .

Еще в разделе: (Показать все результаты (>86) - www.kge.msu.ru/ )

• Search Catalogues
• Search in Internet
• Laboratory of Catalysis and Gas Electrochemistry

... After numberous ways of tyring to remove it using ad aware6.0 and Читать далее cheap the nort , longchamp outl . ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate ...

Еще в разделе: (Показать все результаты (>112) - elana.sinp.msu.ru/ )

• cheap ray bans uk Search assistant spyware can?t remove | С Днем Победы!

Online Services | ... Research) IPN(Institute Physics Nuclear, Paris) ISN(Institute Science Nuclear, Grenoble) JINR(Joint Institute Nuclear Research) JUL-Spez(Institute fur Kernphysik) JYFL(University Jyvaskyla, Finland) LA(Los Alamos Science Laboratory) LBL(Lawrence Berkeley Laboratory) NEANDC(Nuclear Data Committee) ORNL(Oak Ridge National Laboratory) UTTAC(University Tsukuba Center) ZFK(Zentralinstitut fur Kernforschung) **************************************************** Other Code . ... Code: . ...

Еще в разделе: (Показать все результаты (>44) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Nucleus Ground State Parameters
• CDFE => Online Services
• EXFOR Search Engine

... Check out exciting Internet job opportunities at InfoSeek! You searched for: CRDF . ... InfoSeek also offers a more extensive service with access to more than 100 Web pages per search, plus lots of other interesting information--more than 15,000 Usenet newsgroups, continuous newswires, and business, computer, health and entertainment publications. ... This free Web search service handles over 5,000,000 information requests a day and runs on an 8 CPU SparcCenter 1000 provided by Sun Microsystems . ...

Еще в разделе: (Показать все результаты (>613) - xray.sai.msu.ru/ )

• Personal HomePages
• Lipunova Galina Vladimirovna
• Our wonderful group

... FAQ | Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Персональная информация о researcher . ...

Еще в разделе: (Показать все результаты (>3346) - www.snto-msu.net/ )

• Аналитик Executive Search - Public forum of MSU united student networks
• [search.local] Ошибка при индексировании FTP - Public forum of MSU united
• [search] динамичный французский рок - Public forum of MSU united student

... Войти в систему . ... Cifci G. , Limonov A. , Dimitrov L., Gainanov V. в журнале Marine Geophysical Researches , издательство Kluwer Academic Publishers (Netherlands) , том 19, с. 421-438 . ... Artemjev M.E., Babaeva T.M., Mikhailov V.O. , Voydetsky I.E. в журнале Marine Geophysical Researches , издательство Kluwer Academic Publishers (Netherlands) , том 7, ? ...

Еще в разделе: (Показать все результаты (>6753) - istina.msu.ru/ )

• Werner F. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Computers and Operations Research - журнал | ИСТИНА - Интеллектуальная Система
• Kalaidin E.N. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... This 0.5 - year course is devoted to the principles of mathematical modeling in human investigation on physical, economical and social natures. ... Modern Operating Systems . ... This is introductory course to computer network technologies. ... It covers vary basically ISO OSI RM, TCP/IP protocol stack, Ethernet and WiFi principles, core network technologies, PSTN and GSM, main threats and vulnerabilities, and also popular cryptographic technologies and secure network protocols. ...

Еще в разделе: (Показать все результаты (>29) - hcs.cmc.msu.ru/ )

• Master programљ"Decision Engineering in Economics and Finance" | Магистерское и
• Master program "Mathematical and computer methods of image processing" |
• Master program "Software for Computer Networks" | Магистерское и послевузовское

... Main results of different objects studying using scanning probe microscopy methods are 3-dimensional images of these objects usually. ... It gives significantly more convenient image processing, but photographic quality, common for electronic microscopy methods was lost. Information obtained with scanning probe microscope is represented in a computer as numbers in 2 dimensional matrix. ... Thus, every matrix value is represented by point of some colour on a rectangular image. ... Averaging data . ...

Еще в разделе: (Показать все результаты (>157) - www.spm.genebee.msu.ru/ )

• Features searching
• Evgeny Menshikov

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Аналитик Executive Search . ... Egon Zehnder International, a leading global Executive Search Firm is looking for a Researcher . ... Re: Аналитик Executive Search [ re: Daria ] ....

Еще в разделе: (Показать все результаты (>6072) - www.fds-net.ru/ )

• Fast SMB Search on SourceForge - Public forum of MSU united student networks
• Chemists, Attention! Search on databases! - Public forum of MSU united student
• Searching for Андрей Халявин - Public forum of MSU united student networks