Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... This method is designed to be invoked via the TWiki::UI::run method. ... Attach a file to a topic. ... Name of attachment . skin . Skin(s) to use in presenting pages . ... Does not upload the attachment itself, just modifies the meta-data. ... Does the work of uploading a file to a topic. ... Note: Please contribute updates to this topic on TWiki.org at TWiki:TWiki.TWikiUIUploadDotPm . ...

Еще в разделе: (Показать все результаты (>36989) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (17 vs. 18) - TWiki
• IncludeTopicsAndWebPages - TWiki - TWiki - (printable)
• VarURLPARAM - TWiki - TWiki

Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>27) - curl.sai.msu.ru/ )

• . The . MASS . Group .

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Octotron: Active Control for Reliable Functioning of Supercomputers . ... DiMMon: a New Approach to Supercomputer Monitoring . ... X-COM: Distributed Computing Software . ... We propose a new approach to building distributed modular monitoring system named DiMMon, both for current and future systems, with an extremely high degree of parallelism. ... Research Computing Center (RCC) of Lomonosov Moscow State University...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• HOPSA - the joint RF/EU project: HOlistic Performance System Analysis | Moscow
• APPLICATIONS: Electronics and Acoustics | Moscow University Supercomputing
• APPLICATIONS: Radiophysics | Moscow University Supercomputing Center

... Querying File Parameters . Up: File Manipulation Next: File Info Previous: Querying the Size of a File . MPI_FILE_GET_GROUP(fh, group) . ... OUT group] group which opened the file (handle) . int MPI_File_get_group(MPI_File fh, MPI_Group *group) . MPI_FILE_GET_GROUP(FH, GROUP, IERROR) . ... MPI::Group MPI::File::Get_group() const . MPI_FILE_GET_GROUP returns a duplicate of the group of the communicator used to open the file associated with fh. ... MPI_FILE_GET_AMODE(fh, amode) . ...

Еще в разделе: (Показать все результаты (>550) - www.parallel.ru/ )

• mpc.h | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Tuning the P4 device | PARALLEL.RU - Информационно-аналитический центр по
• MPI_Allreduce | PARALLEL.RU - Информационно-аналитический центр по параллельным

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . ...

Еще в разделе: (Показать все результаты (>220) - graphics.cs.msu.ru/ )

• Videocodecs tuning | Graphics and Media Lab
• Videocodecs tuning | Лаборатория компьютерной графики и мультимедиа
• Grants and contracts | Graphics and Media Lab

MЦSSBAUER SPECTROSCOPY V. F. MASTEROV Basic principles of the Mцssbauer spectroscopy are presented. ... 119m 11/2 Sn 89 ї еТЪВ У, З.о., 1998 3/2 23,8 1/2 119 Sn 0 . ... 119Sn. , 119mSn 82 лйкйлйЗлдав йЕкДбйЗДнЦгъзхв ЬмкзДг, <8, 1998 , -, (, ), - . ... 57Fe 119Sn, . ... 2. -, , , 57mFe 119mSn 57Fe 119Sn 140 25,4 . ... абйеЦкзхв лСЗаЙ 2 -2 -1 V, / 0 1 2 3/2 + 1 2 1/2 + CaSnO 3 CaSnO 3 . ... Ca119mmSnO3 , 119SnS еДлнЦкйЗ З.о. е>ллЕДмщкйЗлдДь лиЦднкйлдйиаь 85 : ( ) ( ). , , - ( , ). , , . ...

Еще в разделе: (Показать все результаты (>234) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/lpp14/200809/Litvinovich.pdf
• http://nuclphys.sinp.msu.ru/conf/lpp14/210809/Braguta.pdf
• http://nuclphys.sinp.msu.ru/school/s09/09_23.pdf

diploma thesis abstract of Zjabko I.A. Anisotropy of a parameter of absorption in thin films of polymer polyparaphenilvenylene and donor-acceptor compositions on its basis In the present work are investigated thin a film of the connected polymer of a soluble derivative polyparaphenilvenylene (PPV). ... The received experimental curves are approximated by theoretical dependence and thus required values of optical constants are determined. ...

Еще в разделе: (Показать все результаты (>532) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2010/Yagnyatinskiy_Konovko_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2006/Kostryukov_Tunkin_en.pdf
• Laboratory of nonlinear polarization optics

... public class Attribute . ... They have a name, type and an array of values. ... Attribute (java.lang.String name, double value) . ... If the value represents an array type, returns the Class object representing the component type of the array; otherwise returns null. int . ... Constructor Detail public Attribute (java.lang.String name, java.lang.Number value) . ... public Attribute (java.lang.String name, double value) . ... public Attribute (java.lang.String name, java.lang.Object theValue) . ...

Еще в разделе: (Показать все результаты (>66) - angel.cs.msu.su/ )

• : Interface IndexMap
• PhD Summer School on Scentific Computing
• : Class ProtoVariable

... Fridinger P.G., Reverdatto V.V., Polyansky O.P. Burial sediments metamorphism in rift structures of Earth crust (modeling approach), Geology and Geophysics, 1991, N9, p. 81-90 (in Russian) . ... Reverdatto V.V., Polyansky O.P. PT-evolution in alternative models of metamorphism , Reports of AS USSR, 1992, v.325, N5, p.1017-1020 (in Russian) . ... Reverdatto V.V., Sheplev V.S., Polyansky O.P. , Burial metamorphism and evolution of rift depressions, Petrology, 1995, v.3, N1, p.37-44 (in Russian) . ...

Еще в разделе: (Показать все результаты (>834) - geo.web.ru/ )

Welcome to the site of the Laboratory of Mathematical Models of Quantum Scattering Processes . ... It develops mathematical models of ionizing collisions in atomic, molecular, and condensed matter physics. Main areas of current research activity include single and multiple ionization by electron, ion, and photon impact, ionization processes in strong laser pulses, and laser-assisted ionizing collisions. ... Research | ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>16) - lmmqsp.sinp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The present study aims at developing and testing a new generation of sensor materials based on the whiskers of n-type ZnO and SnO2 and immobilized on the surface of oxide clusters p-type CuO, NiO, PdO, to solve the problem of increasing the sensitivity , selectivity and speed sensor materials to toxic and explosive products in the air. ...

Еще в разделе: (Показать все результаты (>62) - www.lssm.inorg.chem.msu.ru/ )

• Лаборатория химии и физики полупроводниковых и сенсорных материалов | Дирин
• The Laboratory of chemistry and physics of sensor and semiconductor materials |

Next: Items that Define Paths Up: The sendmail.cf File Previous: An Example sendmail.m4 File . A few or the items in the sendmail.m4 file are required all the time; others can be ignored if you can get away with defaults. The following sections describe each of the items in the example sendmail.m4 file in more detail. Items that Define Paths . Defining the Local Mailer . ... Domain Name Service Related Items . Defining Names the Local System is Known by . UUCP-Related Items . ...

Еще в разделе: (Показать все результаты (>275) - itpm.msu.su/ )

• Defining the Local Mailer
• mod_ext_filter - Apache HTTP Server
• ITPM MSU Web Page

... Research laboratories . ... The renewable energy resources geography in Russia and the world. ... Laboratory relationship with research organizations, including international: Moscow Power Energy Institute , Oceanology Institute RAS, Russia s Institute for Rural Electrification RAS, United Institute for High Temperatures RAS, Governmental Energy Strategy Institute , Geography Institute RAS, Experimental Meteorology Institute , Governmental Research ... Renewable energy sources...

Еще в разделе: (Показать все результаты (>110) - eng.geogr.msu.ru/ )

• Research laboratory of recent sediments and pleistocene paleogeography
• Department of Oceanology
• Elbrus teaching and research station

Заседание 320 (24 октября 2014 г., совместное заседание с семинаром механико-математического факультета 'Современные проблемы математики и механики') . ... B. Emek Abali (Технический Университет Берлина) Thermodynamically modeling of nonlinear rheological materials and a new energy-based approach to determine the corresponding material parameters. A thermodynamical system can be described by the field equations that are governed by the balance equations and the appropriate constitutive equations. ...

Еще в разделе: (Показать все результаты (>35) - shamolin2.imec.msu.ru/ )

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>32) - mailybaev.imec.msu.ru/ )

• Book review by Professor Teodor M. Atanackovic
• Curriculum Vitae of Dr Alexei A

Research topics . ... This group is formed to study the reactions at semiconductor surfaces. ... Group members: . ... M.V. Lomonosov Moscow State University: . ... Dr. Tatiana S. Zyubina, senior scientific researcher (quantum chemical modeling) . ... Joint Semiconductors Surface Study group: research sketches . The Joint Semiconductors Surface Study (JSSS) group was developed on the base of Inorganic Chemistry division, Chemistry dept. of M.V. Lomonosov Moscow State University. ...

Еще в разделе: (Показать все результаты (>131) - www.inorg.chem.msu.ru/ )

... A software complex for the analysis and visualization of monitoring and forecast of data on climate changes" . ... Martynova Yu.V., Syshchenko S.P., Skvortsov A.V. A software complex for the analysis and visualization of monitoring and forecast of data on climate changes is considered. ... Keywords: climate change monitoring, information systems, Web-GIS technologies . ...

Еще в разделе: (Показать все результаты (>345) - num-meth.srcc.msu.ru/ )

• "A numerical method of parameter reconstruction in the FitzHugh-Nagumo and
• Application of multiGPU+CPU architecture for the direct numerical simulation of
• "Influence of genetic algorithm parameters on the docking efficiency with the

... Voronin А. Каrmanov D. Savin А. Electronic engineer: . ... Engineer ? ... Electrical design of microprocessor systems, creating software for control and monitoring earth and satellite stations. ... Programming, electrical and layout design of test equipment for testing the silicon matrix for experiment ATIC (Advanced Thin Ionization Calorimeter), creating software for calibration. Electrical design of readout electronics, creating software for collecting and analysis data for experiment NUCLEON . ...

Еще в разделе: (Показать все результаты (>57) - silab.sinp.msu.ru/ )

The Chair of Mathematical Theory of Intelligent Systems and . ... Research . ... Information Monitoring . ... Search in Databases . ... It is possible this apparatus in an applied investigations on recognition of consecutive information. ... Investigation of possibility of using the additional (non-acoustic) sources of information for speech recognition. ... Investigations of possibilities of usage of methods of fussy logic, optimal control and others in solving of problems of speech recognition. ...

Еще в разделе: (Показать все результаты (>103) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: Computer Teacher
• Options dialog
• Intelligent Systems :: Research :: Information Monitoring