... V.V.Shevchenko, Sternberg State Astronomical Institute, Moscow University, Universitetsky 13, Moscow 119899, Russia, shev@sai.msu.ru . ... 1.Sternberg State Astronomical Institute, 119899, Moscow, Russia. shev@sai.msu.ru . ... V.V.Shevchenko, Sternberg State Astronomical Institute, Moscow University, Moscow 119992, Russia, shev@sai.msu.ru . ... 119992 Moscow, Russia; . ... 2Sternberg Astronomical Institute, Moscow University, Moscow, 119992, Russia, . ... Moscow, 119992, Russia shev@sai.msu.ru . ...

Еще в разделе: (Показать все результаты (>154) - selena.sai.msu.ru/ )

• Vladislav V. Shevchenko
• Department of Lunar and Planetary Research

. GMAIL .

Еще в разделе: (Показать все результаты (>27) - astrometric.sai.msu.ru/ )

• ASTROMETRY DEPARTMENT of SAI
• Moscow Universities and Institutes
• Specification

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>6) - physcontrol.phys.msu.ru/ )

About BAFIZ . BAFIZ at SINP MSU . Bafiz' Information Resources at SINP . Other BAFIZ pages . ... At ITEP (Moscow) . This Page is developed at Laboratory of Computational Mathematics, . Department of Radiation and Computational Methods , . Institute of Nuclear Physics, Moscow State University . ... Sergey Bobrovnikov . Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>26) - dbserv.sinp.msu.ru/ )

• BAFIZ
• Information Resources at SINP MSU
• BAFIZ at SINP MSU

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>83) - geophys.geol.msu.ru/ )

• Near-surface electrical prospecting laboratory at Moscow University
• Researchs
• Links of engineering geophysics and software

Home People Activities Research Publications . Yurin's home page . ... Юрин Д.В. "Расчетно-параметрическое исследование флуктуаций сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // Автореферат диссертации на соискание ученой степени кандидата физико-математических наук (специальность 01.04.03-радиофизика). ... Юрин Д.В. "Метод расчета статистических характеристик сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // В кн. ...

Еще в разделе: (Показать все результаты (>22) - imaging.cs.msu.ru/ )

... Second-year students classes . ... The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... As a result, by the and this course, students acquire knowledge about the popular parallel programming techniques, knowledge of modern high-performance computing systems and practical skills to work with them. ... Moscow: Binom...

Еще в разделе: (Показать все результаты (>99) - engineering.phys.msu.ru/ )

... This 0.5 - year course is devoted to the principles of mathematical modeling in human investigation on physical, economical and social natures. ... Modern Operating Systems . ... This is introductory course to computer network technologies. ... It covers vary basically ISO OSI RM, TCP/IP protocol stack, Ethernet and WiFi principles, core network technologies, PSTN and GSM, main threats and vulnerabilities, and also popular cryptographic technologies and secure network protocols. ...

Еще в разделе: (Показать все результаты (>33) - hcs.cmc.msu.ru/ )

• Master program "Mathematical and computer methods of image processing" |
• zavuch's blog | Магистерское и послевузовское образование
• Master program "Software for Computer Networks" | Магистерское и послевузовское

... Boris A. Grishanin is an Associate Professor in the Department of Physics, M.V.Lomonosov Moscow State University (MSU). He received his M.S. and Ph.D. degrees from MSU in 1963 and 1968, respectively (both in Physics). ... B. A.Grishanin's current research interests are in the field of quantum theory of open systems, laser physics, molecular dynamics of photoexcited molecules, problems of quantum information and quantum computing. ... Information theory . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>98) - qilab.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>31) - mouse.genebee.msu.ru/ )

• About
• Align tool for DNA-protein complexes
• ConClus

Department of Archaeology . ... M.N.Kislov worked for many years in the department's laboratory. ... In addition to required courses for student, with a specialized major in any form of archaeology , the department's staff and scholars form other academic institutions, such as the Institute of archaeology RAS, the institute of ethnology RAS, and the State Historical Museum, conduct the following special courses: Paleolithic dwellings , the Stone Age burials (N.B.Leonova), the Stone ...

Еще в разделе: (Показать все результаты (>335) - hist.msu.ru/ )

• Department of Source Studies of Russian and Soviet History
• Dr. Timur Valetov, Faculty of History, Moscow State University
• Department of Ethnology

Optimization of electrospray ionization conditions for more informative mass spectra in structural research of HS for applications in medicine Mikhail A. Kazachkov1, Ivan V. Dubinenkov1, Alexey S. Kononikhin2,3, Igor A. Popov2,3, Irina V. Perminova1, Eugene N. Nikolaev2,3. ... The signal intensity was calculated as a summary intensity of 6 peaks from mass spectra, which were reproduced for each solvent and had high enough intensity even at not optimal conditions. ...

Еще в разделе: (Показать все результаты (>201) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-kunenkov-effective.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-nikolaev-development.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-volikov-synthesis.pdf

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

• Administration

Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...

Еще в разделе: (Показать все результаты (>10) - asa.guru.ru/ )

... Vladimir Ivanovich . ... M.V.Lomonosov Moscow State University, . 119991 Moscow, Russian Federation . ... Department of Chemical Enzymology, Faculty of Chemistry, M.V. Lomonosov Moscow State University, Moscow, Russian Federation . ... Faculty of Chemistry, M.V.Lomonosov Moscow State University, Moscow, Russian Federation . ... Professor, Head of the Laboratory of Genetic Engineering and Protein Design - Faculty of Chemistry , M.V.Lomonosov Moscow State University, Moscow, Russian Federation . ...

Еще в разделе: (Показать все результаты (>209) - www.enzyme.chem.msu.ru/ )

• PubMed medline query
• Lab of phys.-chim. basics of energy bioconversion
• Scientific cooperation

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . ... Department seminar . ... Vladimir Andreev , Moscow State University, Russia . ... Vera Beloshapko , Moscow State University, Russia . Alexander Belov , Moscow State University, Russia . Inna Belukhina , Moscow State University, Russia . Igor Blatov , Povolzhsky State University of Telecommunications and Informatics, Russia . ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>9) - math.phys.msu.ru/ )

... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...

Еще в разделе: (Показать все результаты (>5) - ged.chem.msu.ru/ )

... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...

79. Building Packages for Multiple Architectures and Operating Systems

80. "Phd student in the institute of physical chemistry in warsaw" - вакансия в