... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>55) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

... Livshin Ph.D., professor, School of Public Administration, Lomonosov Moscow State University. ... The image of a foreign country is an important factor influencing political decision-making. ... The image of Japan was an important element of the Soviet propaganda machine used to perform certain political and ideological functions in a crucial period of history. ... Image of the Other , image of authority, political discourse, propaganda, Stalin, Japan, cartoons, manipulation of consciousness. ...

Еще в разделе: (Показать все результаты (>208) - ee-journal.spa.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

• Laboratory of Mechanics of Multiphase Media: Archive 2010

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>2) - scon155.phys.msu.ru/ )

... People . ... Photogallery: Chirinda, Evenkia, July-August 2007 . ... A house where people live . ... Valentina Khristoforovna Yoldogir . ... Audio recording the Evenki word list: the young people are working (Yulia Kombagir and Ilia Yoldogir, Ilia’s brother Misha listening) . ... Valentina Khristoforovna Yoldogir watching the video recording of her telling an Evenki fairy tale . ... Valentina Khristoforovna Yoldogir is telling an Evenki fairy tale to us and to her grandchildren sitting in the tent ....

Еще в разделе: (Показать все результаты (>26) - lcl.srcc.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . news . Panasyuk M. (SINP, Russia). Relec . Klimov S. (ISR, Russia). Wave Research... (SINP, Russia). Relec 1th results . Bogomolov V., Iudin A. (SINP, Russia). Relec TGF-GRB . Bogomolov A., Myagkova I. (SINP, Russia). Hi-energy electrons research...

Еще в разделе: (Показать все результаты (>2) - vernov-relec.sinp.msu.ru/ )

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>17) - imk.msu.ru/ )

... Полная версия этой страницы: Аспирантура в США . Студенческий форум Физфака МГУ > Физфак и учеба > Аспирантура . ... Academic requirements will be completed as part of the Applied Mathematics Program. ... Application information is at:http://www.memphis.edu/gradcatalog/d...g/cas/math.php. ... Applications will be considered as they are received, but not later than December 31, 2011. We look especially for prospective PhD students, but applications for Master's level will be considered as well. ...

Еще в разделе: (Показать все результаты (>715) - wasp.phys.msu.ru/ )

• Аспирантура в США - Студенческий форум Физфака МГУ
• Студенческий форум Физфака МГУ > Barclays Capital 2009
• Студенческий форум Физфака МГУ > Помогите, пожалуйста, скачать статьи

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>94) - srcc.msu.ru/ )

• Conferences
• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial

KRANTZ, THE OLDEST MINERAL DEALER IN GERMANY, AND THE HISTORICAL KRANTZ COLLECTION OF THE MINERAL MUSEUM IN BONN, GERMANY . ... The first part of the talk will give an overview of the history of the mineral dealing business Krantz, a firm, which was founded by Adam August (A.A.) Krantz (photo 1, see Appendix 2) in 1833 and since then has been in the hands of family members [1]. ... The second part of the talk is about the Mineral Museum of Bonn and its historical Krantz collection. ...

Еще в разделе: (Показать все результаты (>388) - geo.web.ru/ )

• Calendar Converter
• The 26 Brightest Stars
• Minarik: Earth Core Studies

Sergei Kulik . ... Department of Quantum Electronics, Faculty of Physics, M.V.Lomonosov Moscow State University, Leninskie gory, 1, str.2, Moscow 119992, GSP-2, Russia, . ... 1986 Graduated from M.V.Lomonosov Moscow State University; . 1991 Ph.D. in M.V.Lomonosov Moscow State University; . ... 2006 - M.V.Lomonosov Moscow State University, . Department of Quantum Electronics, Faculty of Physics, Head of Quantum Information lab . 2003 - M.V.Lomonosov Moscow State University, . ...

Еще в разделе: (Показать все результаты (>69) - qi.phys.msu.ru/ )

• PUBLIC

... This summer, July 31 ? August 9, four CMC MSU students took part in GSIS Homogenization and Numerical Analysis International Summer School in Sendai, Tohoku University, Japan. ... The support operator method for modeling fluid flow in elastic vessels" by Nikita Afanasiev (Dept. of Computational Methods, CMC MSU), . ... Delegation from Tohoku University (Japan) at CMC MSU . CMC MSU ? ... View the full image . ... CMC MSU students at GSIS Summer School, Tohoku University, Japan . ...

Еще в разделе: (Показать все результаты (>60) - en.cs.msu.ru/ )

• Information for foreigners who wish to study at our Faculty
• Information for foreigners who wish to study at our Faculty | CMC MSU
• CMC MSU students at GSIS Summer School, Tohoku University, Japan

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>76) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design. Part 4

... P hysics Faculty, Moscow State University, . ... Moscow State University, Physics Faculty, Diploma work in Hydrodynamics . ... Title: «Dynamical Stochasticity of Nonlinear Systems and a Prediction Problem» . ... The First International School-Conference BILLIARDS’09 – « Mathematics and Physics of Billiard-Like Systems », February 16-19, 2009, guas de Lindoia, SP, Brazil . ... Invited Lectures «Chaos in Dynamical Systems», The Space Research Institute, Russian Academy of Science, Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>73) - chaos.phys.msu.ru/ )

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>9) - sbmg.geol.msu.ru/ )

Вы посетили: inv_engl.html . ... История кафедры . ... Visiting Professor at the University of Oslo, Norway, Oslo, November, 2010 . ... Visiting Professor at the University of Ljubljana, Slovenia, August, June 2010 . ... Visiting Professor at the University of Patras and the University of Athens, Greece, June-July 2009 . ... Visiting Professor at the University of Stockholm, Sweden, January ? ... staff/guterman/inv_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>19) - halgebra.math.msu.su/ )

• staff:guterman:activ_rus.html | Кафедра высшей алгебры
• staff:guterman:conf_engl.html | Кафедра высшей алгебры
• staff:guterman:conf_rus.html | Кафедра высшей алгебры

... Moscow State University . Russian Academy of Sciences . ... December, 2015 (Moscow State University, Department of Physics) . ... June, 2013 (Moscow State University, Department of Chemistry) . ... August, 2012 (Moscow State University, Department of Physics) . ... June, 2012 (Moscow State University, Department of Chemistry) . ... June, 201 1 (Moscow State University, Department of Materials Science) . ... 2015 (Moscow State University) . ... 2012 (Moscow State University) . ...

Еще в разделе: (Показать все результаты (>29) - nanofluidics.phys.msu.ru/ )

• Laboratory of Micro- and Nanofluidics

... D. CHASHECHKIN ON INTERNAL WAVES (compiled by Bruno Voisin on 12 October 2007) Emission of linear lee waves Three-dimensional waves from a sphere Makarov, S. A. & Chashechkin, Yu. D. (1981) Apparent internal waves in a fluid with exponential density distribution. ... Transl. from Zh. ... Received 13 October 1980. ... D. (1998) Localized and volume internal waves in a stratified fluid contiguous to a mixed layer. ... V. (1998) Monochromatic internal waves in an arbitrarily stratified viscous fluid. ...

Еще в разделе: (Показать все результаты (>13) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/pubs/Chashechkin-All.pdf

... In the given practical special course we address user techniques for working with Linux OS; we study the interface of the command line in great detail, methods of automation and batch processing, composition of scientific articles as well as the specifics of software design by using in-built toolkit. ... The first version of the nucleus of Linux operating system was written more than 20 years ago by a student, just like you, as his second-year coursework. ... Sekunov N. Programming on C++ in Linux. ...

Еще в разделе: (Показать все результаты (>26) - engineering.phys.msu.ru/ )

• Mitsubishi Electric met our laboratory