Estimation of selection pressure on degenerate sequences in genomes: choice of method I.S. Rusinov,1 A.S. Ershova, 1 2,3,4 A.S. Karyagina, 2,3,4 S.A. Spirin, 1,2,5 A.V. Alexeevski 1,2,5 Lomonosov Moscow State University, Faculty of Bioengineering and Bioinformatics, Moscow 119992, Russia;2Lomonosov Moscow State University, Belozersky Institute of Physical and Chemical Biology, Moscow 119992, Russia; 3Gamaleya Institute of Epidemiology and Microbiology, ...

Еще в разделе: (Показать все результаты (>101) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/48.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/19.pdf

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

... The documents on academic background should be translated into Russian and attested by the Russian Embassy in the country where the documents were issued, or by the Embassy of your country in Russia, or by a notary in Russia. Graduation certificate of the Center for International Education at MSU, or Preparatory Course at a state university in Russia, or Certificate of the Russian Language test and tests in Physics and Mathematics, . ... Russian Language Summer Program . ...

Еще в разделе: (Показать все результаты (>12) - foroff.phys.msu.ru/ )

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>87) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help
• GeneBee BLAST 2.2.22+ Services .

... Structure and properties of chimeric small heat shock proteins containing yellow fluorescent protein attached to their C-terminal ends. ... Recombinant chimeras of small heat shock proteins (sHsp) HspB1, HspB5, and HspB6 containing enhanced yellow fluorescent protein (EYFP) attached to their C-terminal ends were constructed and purified. Some properties of these chimeras were compared with the corresponding properties of the same chimeras containing EYFP attached to the N-terminal end of sHsp. ...

Еще в разделе: (Показать все результаты (>7) - biochem.bio.msu.ru/ )

... The "diagrams of minimum expected tsunami arrival time" are shown for 25 coastal sites; the TWS dead zones for each of these sites are distinguished by more frequent isolines (every 1 min). ... I ( is the site name). ... We presented isolines of minimum expected tsunami time for all these sites. ... However, there are also sites, In every such case the minimum expected tsunami time tmin has to be to the minimum tsunami propagation time at the distance R in the direction to the respective settlement....

Еще в разделе: (Показать все результаты (>9) - seac47-2.phys.msu.ru/ )

Backlinks to TimeSpecifications in all Webs ( Search System Web only ) . ... NEW - 19 Sep 2010 - 15:29 by ProjectContributor . ... Query Search Query searches help you search the contents of forms attached to your topics, as well as the values of other meta data attached to the topic. Using query .. ... VarSEARCH SEARCH{"text"} search content * Inline search, shows a search result embedded in a topic * Syntax: %SEARCH{"text" .. ... Ideas, requests, problems regarding Foswiki? ...

Еще в разделе: (Показать все результаты (>18194) - wiki.cs.msu.ru/ )

• (backlinks in System Web) VarQUERY < System < Foswiki
• (backlinks in System Web) TimeSpecifications < System < Foswiki
• (backlinks in all Webs) VarQUERY < System < Foswiki

Warning : oci_connect(): ORA-12543: TNS:destination host unreachable in / home / swx / public_html / models / sw_forecast.php on line 3 Warning : oci_parse() expects parameter 1 to be resource, boolean given in / home / swx / public_html / models / sw_forecast.php on line 4 Warning : oci_execute() expects parameter 1 to be resource, null given in / home / swx / public_html / models / ...

Еще в разделе: (Показать все результаты (>10) - swx.sinp.msu.ru/ )

• http://swx.sinp.msu.ru/models/get_charea.php

... please find attached the second announcement about the VII Moscow International Conference on Operations Research (ORM2013) in October, 15-19, 2013 in Moscow, Russia. You are welcome to submit extended abstracts of your talks to 2013ORM@gmail.com. An extended abstract should be presented as a LaTex file in English language according to the attached template, and its volume should be three pages (or little less). Selected extended abstracts will be published in the Conference proceedings. ...

Еще в разделе: (Показать все результаты (>9) - io.cmc.msu.ru/ )

. To be sent no later than July 15 1999 . Surname First names : . Organisation/Institution: . Mailing address: . Email : . Telephone : . Fax (Full International) : . I expect to attend the Conference: . sure probably . I expect to be accompanied by . I expect to present a paper . Title of paper . Topic of the Conference . I expect to present a poster . Title of poster . Topic of the Conference .

Еще в разделе: (Показать все результаты (>113) - www.fadr.msu.ru/ )

• Abstracts
• Paleopedology Comission Web-site
• Untitled

Team . Team has been working in the field of geoinformation technology more than 20 years. Members of the team have fundamental knowledge and experience both in modern information technology and in seismology. ... Information technology for developing of the map of maximum possible magnitudes (M max ) of expected earthquakes. Information technology for detection of earthquake precursors. ... The technology is supported by geoinformation system named Geo 2.5 . ...

Еще в разделе: (Показать все результаты (>218) - geo.web.ru/ )

• Asian Current Research on Fluid Inclusions (ACROFI III) International
• Informal geological society

... O(10 08/15/ 2009 Marcello A. Giorgi 3 Some model predictions In SUSY LFV decays are generated via slepton mixing Undetectable 08/15/ 2009 Marcello A. Giorgi 4 Looking at NP flavor structure · Different models expect different processes leading to LFV in charged sector · If LFV is observed NP flavor structure may be investigated by looking at LFV BF Ratios. [arxi : hepph/ 0610344v3 and hepph/0702136] iv 08/15/ 2009 Marcello A. Giorgi 5 PePII and ... A single rotation angle is used . ...

Еще в разделе: (Показать все результаты (>97) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/lpp14/240809/Petrushanko.pdf
• http://nuclphys.sinp.msu.ru/neutrino/Egorov-02-11-2010.pdf
• http://nuclphys.sinp.msu.ru/nseminar/antares_nemo.pdf

... B Design and developmentof a new vacuum chamber for the tests of Q-factors in suspension's modes . ... E New SQL free principle of coordinate monitoring of the test mass . F Appendix I . ... The achieved p new resolution 2 10;11cm= Hz was su cient to record Brownian vibration with relative accuracy better than 10% (see details in Appendix I). ... See details in Appendix IV) E. New SQL free principle of coordinate monitoring of the test mass The new concept of quantum measurement | ...

Еще в разделе: (Показать все результаты (>120) - hbar.phys.msu.ru/ )

• Age Determinations by Radiocarbon Content: Checks with Samples of Known Age

... HelpOnActions/AttachFile . ... The AttachFile action lets a page have multiple attached files. ... To create a new attachment, you can either add an attachment link to any page (see below on how to do that), or click on the AttachFile link at the bottom of the page. ... показать ] (2011-09-26 10:58:10, 7.4 KB) [[attachment:move_example1.png]] . ... показать ] (2011-09-26 10:58:10, 3.7 KB) [[attachment:unzip1.png]] . ... To refer to attachments on a page, use [[attachment:a file with blanks.txt]] . ...

Еще в разделе: (Показать все результаты (>72) - uneex.mithril.cs.msu.su/ )

• HelpOnLinking - UNИX
• PspoClasses/080722/03NetInstall - UNИX
• HelpOnParsers/ReStructuredText - UNИX