Testing the hypothesis on the 'drift' of parameters in the moving average model / I. G. Erlikh. Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. 2009. ... Test statistics for checking the conformity of the moving average model to observations are constructed. The statistics are based on sequential processes constructed using residuals and compatible with the equation for estimation of the unknown parameter of the model postulated. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>14) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Editorial
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Âåñòíèê

Next] [Previous] [Top] [Contents] [Index] [netCDF Home Page] [Unidata Home Page] . ... The purpose of the Network Common Data Form (netCDF) interface is to allow you to create, access, and share array-oriented data in a form that is self-describing and portable. ... Using the netCDF interface in software for data access, management, analysis, and display can make the software more generally useful. The netCDF software includes C and FORTRAN interfaces for accessing netCDF data. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>43) - angel.cs.msu.su/ )

• : Package ucar.multiarray
• : Class RemoteNetcdf
• NetCDF User's Guide for C

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>2) - moodle.ffl.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>36) - brain.bio.msu.ru/ )

Intel Thread Checker 2- pozdneev@gmail.com . Intel Thread Checker 14 2008 1 / 26 1 Intel Thread Checker 1: Intel Thread Checker 2: Intel Thread Checker 14 2008 2 / 26 2 3 4 5 6 7 ( ) Microsoft Windows Intel Thread Checker / «» (Intel Software Development Tools Intel(R) Thread Checker x.x) icl ( Intel Software Development Tools Intel C++ Compiler xx.x.xxx C++ Build Environment for applications running on . ... 1 |Write -> |Err|4|omp|Memory read of glb_primes_found at |"prim|"prim| ... Read |or | ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>4) - angel.cmc.msu.ru/ )

Íîâîñòè . ...  êîíöå ôåâðàëÿ 2012 ãîäà â ÌÃÓ ïðèåçæàåò ïðîôåññîð ïî óðáàíèñòèêå â ÑÓÍÈ â Áóôôàëî Äàíèåë Õåññ (Daniel B. Hess) http://www.ap.buffalo.edu/planning/people/hess.asp. 27 ôåâðàëÿ îí ïðî÷òåò ëåêöèþ Ñâÿçü ìåæäó äîñòóïíîñòüþ ê òðàíñïîðòó è ñòîèìîñòüþ æèëüÿ (The Relation Between Access to Transportation and Property Value: Theory and Application). 22 ÿíâàðÿ 2012 ãîäà ïðèáûâàåò ïðîôåññîð ÑÓÍÈ Ðîáåðò Õîâåëë â êà÷åñòâå àêàäåìè÷åñêîãî äèðåêòîðà Öåíòðà ïî Ðîññèè è ÑØÀ. ... ìãó-ñóíè . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>9) - suny.msu.ru/ )

• Center on Russia and the United States :: News

... Moskovsky Alexander . ... Rogov Alexander . Modeling the reaction of hydrolysis of peptide bonds by trypsin by using quntum mechanical - molecular mechanical methods . ... Title: "Modeling Spectra of Molecular Clusters by Quantum Chemistry and Molecular Dynamics Methods" . ... Title: "Development of the Combined Quantum Mechanical - Molecular Mechanical Methods" . ... Title: "Modeling mechanisms of enzymatic hydrolysis reactions by the combined quantum mechanical - molecular mechanical methods" . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>2) - lcc.chem.msu.ru/ )

LABORATORY . ... It was founded by two young Candidates of Philology who had just got their scientific degrees Boris Andreevich Uspensky and Vladislav Mitrofanovich Andruschenko as interdepartmental laboratory based on three departments: the English Language Department of the Philological Faculty, Foreign Languages Department for the Humanities and Arabic Department of the Institute for Asia and Africa. ... Vladislav Mitrofanovich Andruschenko was at the Head of the Laboratory from 1964 till 1983. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>3) - lcl.srcc.msu.ru/ )

... Invariants for Generalised Burgers Equations . ... Recently, one of the authors (NHI) adopted the infinitesimal method for calculating invariants of families of differential equations using the equivalence groups. ... Here, we use the above method for calculating invariants of the family of generalised Burgers equations which has applications in acoustic phenomena and furthermore has been used to model turbulence and certain steady state viscous flows. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>19) - acs366.phys.msu.su/ )

• AUTHOR : Ibragimov N
• AUTHOR : Sophocleous C

... Ãåîëîãèÿ >> Èíôîðìàöèîííûå òåõíîëîãèè | ... Ïðîãðàììà èùåò è ïîêàçûâàåò çàêîíîìåðíîñòè â îðãàíèçàöèè ëèíåéíûõ ýëåìåíòîâ äèñòàíöèîííûõ äàííûõ. ... Ñ íå ìåíüøèì îñíîâàíèåì ìîæíî àíàëèçèðîâàòü ðèñóíîê õðåáòîâ è äîëèí â öèôðîâûõ ìîäåëÿõ ðåëüåôà (ÖÌÐ). ... È, íàêîíåö, LESSA ïîçâîëÿåò àíàëèçèðîâàòü áèíàðíûå ñõåìû ïîëó÷åííûå ëþáûì äðóãèì ïóòåì, íàïðèìåð, ñõåìû ðó÷íîãî äåøèôðèðîâàíèÿ ëèíåàìåíòîâ, ñõåìû ãèäðîñåòè è ò.ä. ( ïîäðîáíîñòè íà ñàéòå http://www.lineament.ru ) . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>118) - geo.web.ru/ )

• Pavel Yu. Pletchov
• COMPASS
• Àâòîðñêèé ñàéò Âëàäèìèðà Ìàëüöåâà - ëèòåðàòóðà

Open Conference Systems . Conference Help . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... For Readers . ... Home . ... Search . Current Conferences . Home > ICONO/LAT 2016 > About the Conference > Conference Policies . Archive Access Policy . The presentations that make up the current and archived conferences on this site have been made open access and are freely available for viewing, for the benefit of authors and interested readers. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>25) - hea.phys.msu.su/ )

• About the Conference

... 104 n C : (10- ) Q2 = 0.801 , RMSE = 3.33 / SVR: Nu = 0.72, Log2(c) = 12.6, Log2(g)= -18.7 PRESS q2 1 1 SS i 1 ( yi y p r ed 2 i ) i 1 n ( yi y ) 2 SVR 300 , 200 100 0 -100 -100 , ­ 0 100 200 300 ­ 515 C : (10- ) Q2 = 0.907 , RMSE = 15.82, 0 PRESS q2 1 1 SS i 1 n ( yi y p r ed 2 i ) i 1 n ( yi y ) 2 Q2 n T g DCV RMSEDCV 0.033 45.0 0.159 MAEDCV 0.021 32.0 0.096 Q2 DCV RMSEDCV 0.026 42.7 0.066 MAEDCV 0.015 28.0 0.043 0.782 0.849 0.474 0.872 0.864 0.910 : n ­ 298K; Tg ­ ( K); ­ (/3, 298). ... 2007, 3. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>55) - polly.phys.msu.ru/ )

• Seminar in Polymer Physics

... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... TPPMKOP is an utility developed for the automatic topology generation working well with OPLS-AA force field. ... This database is continually upgrading by our research group. ... OPLS-AA patch for different types of molecules ERG Research Group: Ëàáîðàòîðèÿ òåîðåòè÷åñêîé áèîôèçèêè íàïèñàë (Ôåâðàëü 8th, 2016 4:27 äï) . ... All-atom automatic OPLS-AA topology generator . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>17) - erg.biophys.msu.ru/ )

• Constructing discrete Laplacian via sparse matrix ERG Research Group:
• Using spherical functions (from A.Granovsky manual) ERG Research Group:

Statistics in Morse theory of smo oth functions Vladimir I. Arnold Steklov Mathematical Institute, Moscow, Russia e-mail: arnold@mi.ras.ru There are exactly 17746 topologically distinct Morse functions with 4 saddles on the two dimensional sphere. This result basing on combinatorics of random graphs was obtained only two years ago within an investigation of Hilbert's 16th problem on topological classification of polynomials in real algebraic geometry. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>6) - pont2008.cmc.msu.ru/ )

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>90) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]
• new-mac [CompHEP]
• downloads [CompHEP]

The Octotron Approach: Towards Autonomous and Reliable Operation of Supercomputers Alexander Antonov, Dmitry Nikitenko, Pavel Shvets, Sergey Sobolev, Konstantin Stefanov, Vadim Voevodin, Vladimir Voevodin, Sergey ... @parallel.ru Research Computing Center, M.V.Lomonosov Moscow State University, Moscow, Russia Project Goals · to discover all types of failures in supercomputers as well as their root causes and relationships; · to react automatically to any ... Model-based Approach Benefits 1. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>29) - hpc.msu.ru/ )

• http://hpc.msu.ru/files/HPC/ISC_2015_Posters_attachment_14.pdf
• SIGMA: Collective Bank of Tests on Parallel Computing | Moscow University
• HOPSA - the joint RF/EU project: HOlistic Performance System Analysis | Moscow

... Âåðíóòüñÿ ê ïðåäûäóùåé çàäà÷å . ... Çàäà÷à ?13 . ÎÏÐÅÄÅËÅÍÈÅ ÔÈÇÈ×ÅÑÊÈÕ ÏÀÐÀÌÅÒÐΠÃÀÇÀ  ßÄÐÅ . ÑÅÉÔÅÐÒÎÂÑÊÎÉ ÃÀËÀÊÒÈÊÈ . ... ßäðî õàðàêòåðèçóåòñÿ íåîáû÷àéíî øèðîêèìè ýìèññèîííûìè ëèíèÿìè, ñâèäåòåëüñòâóþùèìè î äâèæåíèè ãàçà ñî ñêîðîñòÿìè â òûñÿ÷è êì/ñ.  íàñòîÿùåé çàäà÷å èññëåäóåòñÿ ñïåêòðîãðàììà ÿäðà ñåéôåðòîâñêîé ãàëàêòèêè, è ïî îòíîñèòåëüíûì èíòåíñèâíîñòÿì ñïåêòðàëüíûõ ëèíèé îïðåäåëÿþòñÿ ôèçè÷åñêèå ïàðàìåòðû èçëó÷àþùåãî ãàçà. ... Îïðåäåëèòü ïàðàìåòðû ãàçà â ÿäðå ñåéôåðòîâñêîé ãàëàêòèêè. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>12) - heritage.sai.msu.ru/ )

• À.Â.Çàñîâ. Çàäà÷à 14: Îïðåäåëåíèå öâåòà è ìîðôîëîãè÷åñêîãî òèïà óäàëåííîé
• À.Â.Çàñîâ. Çàäà÷à 12: ÏÇÑ-Ôîòîìåòðèÿ Ãàëàêòèêè

Measurements of B ð Xsl+l- and BðK(*) l+l- at Belle A. Ishikawa (KEK) 18, Aug, 2004 32 nd International Conference on High Energy Physics BICC, Beijing, China Introduction n bðs l+l Å Å Å Å - Å First observed by Belle in BðKll Proceed through penguin, Z penguin and W box diagrams Sensitive to new physics Sign of Wilson coeffient C7 as well as C9 and C10 can be obtained from q2 distribution and AFB(q 2). ... Four background sources Å Å Å Å dilepton events from continuum, mostly from charm events. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>91) - nuclphys.sinp.msu.ru/ )

• ESHEP-2013

... The quantum properties of the atom's radiation (intensity and the resonance fluorescence spectrum, photon antibunching, quadrature squeezing, statistics of fluorescent photons) depend on magnitude and polarization of the incident electromagnetic wave, the decay rate of the atom, the transition frequency. The key fact is that the nanoantenna strongly modifies the magnitude and the polarization of the local field, the decay rate of the atom and the transition frequency. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>13) - ofvp.phys.msu.ru/ )

• ILC MSU