... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>17) - angel.cs.msu.su/ )

... A This result can be applied to a wide variety of data sets, including electricity bills1, street addresses, lengths of rivers, physical and mathematical constants, and processes described by power laws. ... Based on the plausible4 assumption that people who make up figures tend to distribute5 their digits fairly uniformly, a simple comparison of first-digit frequency distribution from the data with the expected distribution according to Benford's law had to show up any anomalous results. ...

Еще в разделе: (Показать все результаты (>16) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Academic_English_4.pdf

... Summury: Usually a water column consists of two big layers. The upper layer (10-50 m deep) is characterized by strong mixing, as a result, both the biomass and nutrients are nearly uniformly distributed there. ... In this article we show that in the presence of an upper mixed layer (UML) there can be two stable vertical distributions of phytoplankton biomass: either the bulk of the biomass is located within the upper layer or below it. ...

Еще в разделе: (Показать все результаты (>67) - chaos.phys.msu.ru/ )

• Alexey Ryabov. Research

Natalia Ratnikova, Andrea Sciaba, Stephan Wynhoff, CMS 2001 Projects @ CERN JAN FEB MAR 2002 DISTRIBUTING APPLICATIONS IN DISTRIBUTED COMPUTING ENVIRONMENT Software distribution is a process of delivering software products to the users. ... The distribution system not only addresses the question, how to make software available to the users in a reasonable time, but also how to insure that software that is used in different research centers produces the same result? ...

Еще в разделе: (Показать все результаты (>64) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/tobimatsu/tobimatsuk.pdf

Studying islands is a very interesting subject for ecology, systematic and biogeography. ... These islands are generally small and do not have a big list of vascular plant species, which removes a lot of complications in their study. ... This is also true for most of the islands of the Tchupa gulf and to the ones East and Northeast from its mouth in the Kiv gulf and east from Sidorov island. ... Mainland-gulf (12%) - Plants with this areal type are found on al gulf islands we studied. ...

Еще в разделе: (Показать все результаты (>190) - herba.msu.ru/ )

• Systema Naturae
• Publications about flora
• Complete flora of islands and lakes as a statistical hypothesis

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>118) - elana.sinp.msu.ru/ )

• cheap moncler jackets Eagle Broadband Picks Terremark NAPEagle says it selected
• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>16) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/Shirokov%20-%20The%20first%20results%20of%20MSU%20groups%20in%20ANTARES%20project.pdf
• http://antares.sinp.msu.ru/docs/2010_Amsterdam_Kulikovskiy.pdf

... 2015 . ... The author uses the methods and approaches of redistribution economy in the analysis of the development of timber industry of the Karelian ASSR in the mid 1960s. The role of the Institute of Redistribution as a major factor of regional economy in the system of relations between the Center and Region was examined using unique archival materials never before analyzed scientifically. ... Redistribution economy, institute of redistribution, timber industry, Karelian ASSR. ...

Еще в разделе: (Показать все результаты (>65) - ee-journal.spa.msu.ru/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>5451) - kodomo.fbb.msu.ru/ )

• allpy: log

Subdeletion structures as additional evidence for different analysis of synthetic and analytic comparatives in Russian In Russian there are two seemingly interchangeable comparative forms of adjectives: synthetic (the suffix -ee) and analytic (the word bolee). ... One more peculiar characteristic pertaining to synthetic rather than analytic comparatives in Russian is the inability of the former to appear in so-called subdeletion structures. ... Masa vyse Vani. i(analytic+GEN). ... Pancheva, Roumyana. ...

Еще в разделе: (Показать все результаты (>233) - www.philol.msu.ru/ )

• LangueDOC :: Movie

... My research topic is application of the theory of dynamical systems to models of excitable media. ... One of the remarkable examples of an excitable medium is heart tissue. ... We have observed dynamics of phase singularities using some of the techniques for PS detection on the base of just one framework three-variable Fenton-Karma model with different parameters sets to reproduce various mechanisms of spiral wave breakup which in principle can occur in cardiac tissue. ...

Еще в разделе: (Показать все результаты (>202) - polly.phys.msu.ru/ )

• Scientific
• Anna Bodrova
• NATO Scientific Environmental Affairs

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>194) - vestnik.math.msu.su/ )

... Symmetry in Bubble Dynamics . ... An investigation on novel lines is made into the problem of nonlinear bubble dynamics. ... The complete symmetry groups are found for the Rayleigh equation. ... The possible application of the scaling law dynamics to the problem of stable single bubble sonoluminescence is discussed. Conformal symmetry of Laplace equation provides an approach for finding exact solutions for the pulsation of gas bubble tethered to a rigid wall. ...

Еще в разделе: (Показать все результаты (>319) - acs366.phys.msu.su/ )

Measurements of B р Xsl+l- and BрK(*) l+l- at Belle A. Ishikawa (KEK) 18, Aug, 2004 32 nd International Conference on High Energy Physics BICC, Beijing, China Introduction n bрs l+l Е Е Е Е - Е First observed by Belle in BрKll Proceed through penguin, Z penguin and W box diagrams Sensitive to new physics Sign of Wilson coeffient C7 as well as C9 and C10 can be obtained from q2 distribution and AFB(q 2). ... Four background sources Е Е Е Е dilepton events from continuum, mostly from charm events. ...

Еще в разделе: (Показать все результаты (>212) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/nseminar/08_09_09.pdf
• http://nuclphys.sinp.msu.ru/conf/lpp14/210809/Peshekhonov.pdf
• http://nuclphys.sinp.msu.ru/school/s08/s08_21.pdf

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>211) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC
• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>20) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/guidetomarketresearch.doc
• http://www.innovation.msu.ru/english/reportofinvention.doc

... The main field of my investigations is stellar spectrophotometry. As a result of scientific activity of our group spectrophotometric catalog was created including energy distribution data on 900 stars in the range 3200-7600AA and 250 stars in the range 6000-10800AA (Voloshina et al., Spectrophotometry of Bright Stars, ed. I.N.Glushneva, 1982, Moscow, Nauka, in Russian). ...

Еще в разделе: (Показать все результаты (>10) - uranus.sai.msu.ru/ )

... Distribution of neutron counting rate near the Earth surface is studied in two directions - to the Earth and from it - according experimental data, obtained in Moscow in 1996. ... We suppose that logarithmically normal distribution describes an input of the Earth crust into the neutron flux. ... Usual periods . ... Full approximation of thermal neutrons distribution near the Earth crust is presented as a sum of two functions - Poison distribution and logarithmically normal distribution. ...

Еще в разделе: (Показать все результаты (>98) - www.kosmofizika.ru/ )

• Магнитосферно-ионосферное взаимодействие ( M-I coupling)
• Science Technology: Ongoing Solar Activity
• Оригинальные статьи, PDF (English)l

... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>4) - www.students.chemport.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out