... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>22) - iconolat13.phys.msu.ru/ )

• Visa to entry Russia
• Invited speakers

. Jump to: navigation , search . You must log in to view other pages. Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Main_Page " . Page . Discussion . View source . History . Log in . Новости, главное . Страница курса . Сдача заданий . 1-й семестр 2015 г. Материалы по системе ejudge . Планы прошлых лет . Участники . Recent changes . What links here . Related changes . Special pages . Printable version . Privacy policy . About MediaWiki . Disclaimers

Еще в разделе: (Показать все результаты (>62) - algcourse.cs.msu.su/ )

... Zelikin Mikhail Ilych . Deputy Head of the Department . ... general theory of optimal control, homogeneous spaces and Riccati differential equations, qualititative theory of differential and finite-difference equations, integrable systems, differential games, optimal synthesis with chattering, minimization of multiple integrals. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>123) - new.math.msu.su/ )

• Scientific directions | Department: General Problems of Control. Faculty of
• Seminars of the department | Department: General Problems of Control. Faculty
• Current staff list | Department: General Problems of Control. Faculty of

... Bachelor Program . ... The Department of Operations Research . ... Department of Operations Research was founded in 1970 by an outstanding scientist Yury Borisovich Germeier , who played a large role in development of operations research and game theory. ... Department develops both traditional disciplines, such as game theory, optimization theory and methods , mathematical models in economic analysis, and new fields related to modeling of market economy, banking and insurance activity. ...

Еще в разделе: (Показать все результаты (>30) - io.cmc.msu.ru/ )

• The Department of Operations Research

... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

... In addition to the direct effect of acidic solutions on tree crowns, resulting in tissue damage and leaching of metabolites, the acid impact modify soil properties, which is believed to be the most important in forest degradation. ... We assessed critical loads of acid deposition and their exceedance for forest soils in the European part of the former Soviet Union using a simple balance method and mapped them within 1.0°x0.5° longitude per latitude grid cells. ...

Еще в разделе: (Показать все результаты (>27) - eco.soil.msu.ru/ )

• Koptsik G.N., et al. Soils of the National Park "Russian North".
• ASSESSMENT OF SOIL SUSTAINABILITY TO ACID DEPOSITION

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>55) - acoustics.phys.msu.ru/ )

... Другие названия журнала: J. Inv. ill-posed problems , J. Inverse and Ill-posed Problems , J. Inverse and Ill-Posed Probl показать полностью.. J. of Inverse and Ill-posed Problems , Journal Inverse and Ill-Posed Problems , Journal of Inverse and Ill-posed Problems . ... Wang Y. , Yagola A.G. в журнале Journal of Inverse and Ill-Posed Problems , издательство V S P (Netherlands) , том 24, ? ... 2012 Numerical method for solving an inverse electrocardiography problem for a quasi stationary case . ...

Еще в разделе: (Показать все результаты (>2116) - istina.msu.ru/ )

• Inverse Problems - журнал | ИСТИНА - Интеллектуальная Система Тематического
• Problems of Information Transmission - журнал | ИСТИНА - Интеллектуальная
• Contemporary Problems of Ecology - журнал | ИСТИНА - Интеллектуальная Система

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... JAPANESE PROGRAM 2016 1st term [TUJP-1]: July 4th to July 19th, 2016 2nd term [TUJP-2]: July 25th to August 9th, 2016 What's TUJP? This summer intensive program provides students of our partner institutions with an opportunity to discover Japan through diverse learning experiences in English. ... PROGRAM SCHEDULE 1st term [TUJP-1]: Monday 4th July, 2016 to Tuesday 19th July, 2016 2nd term [TUJP-2]: Monday 25th July, 2016 to Tuesday 9th August, 2016 Applying for two consecutive terms (ex. ...

Еще в разделе: (Показать все результаты (>169) - phys.msu.ru/ )

• http://phys.msu.su/rus/international/intl-collaboration-agrmnts/docs/TSSP2016_Leaflet.pdf
• http://phys.msu.su/upload/iblock/fc7/Circular_1-NPAE-Kyiv2012.pdf
• SAMSUNG EDUCATIONAL PROGRAMS

... Energy-linked binding of Pi is required for continuous steady-state proton-translocating ATP hydrolysis catalyzed by F0.F1 ATP synthase. ... The data are interpreted to suggest that coupled and uncoupled ATP hydrolysis catalyzed by Fo.F1 ATP synthases proceeds via different intermediates. ... Pi dissociates before ADP during uncoupled ATP hydrolysis, leaving the E.ADP intermediate which is transformed into the inactive ADP(Mg2+)-inhibited form of the enzyme (latent ATPase). ...

Еще в разделе: (Показать все результаты (>101) - biochem.bio.msu.ru/ )

• Phosphorylation of more than one site is required for tight interaction of

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )

. [ Войти ] . Главная -> Фильмы -> Nudity Required . Пользователи . Демо . Деньги . Фильмы . Форум . Nudity Required . США 2003 . отметить . Комедия .

Еще в разделе: (Показать все результаты (>187) - kinfo.ru/ )

• Some Nudity Required - Фильмы - Kinfo.ru
• When Strangers Appear - Фильмы - Kinfo.ru
• Problem Child - Фильмы - Kinfo.ru

... C*-algebras and Morse numbers of manifolds . 10:00-10:45 . ... COFFEE BREAK . ... Multipliers of $C^*$-algebras and Hilbert $C^*$-modules . ... On lifting problems in C*-algebras . ... Homological dimensions of the algebras of smooth and holomorphic functions on the quantum torus . ... DINNER . ... C*-algebras approach . ... CONFERENCE DINNER . ... Classification results for differentiable extensions of generalized cohomology theories . ... Noncommutative elliptic theory over C*-algebras . ...

Еще в разделе: (Показать все результаты (>171) - higeom.math.msu.su/ )

• C*-algebras: Talks
• S.P.Novikov Seminar
• C*-algebras and elliptic theory

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...

Еще в разделе: (Показать все результаты (>7) - ani.cs.msu.su/ )

... 2, JUNE 2007 1185 Commissioning of the CMS Magnet Domenico Campi, Benoit CurИ, Andrea Gaddi, Hubert Gerwig, Alain HervИ, Vyacheslav Klyukhin, Gilles Maire, Goran Perinic, Philippe BrИdy, Philippe Fazilleau, Francois Kircher, Bruno LevИsy, Pasquale Fabbricatore, Stefania Farinon, and Michela Greco Abstract--CMS (Compact Muon Solenoid) is one of the large experiments for the LHC at CERN. ... The construction of the CMS Magnet, and of the coil in particular, has been completed last year. ...

Еще в разделе: (Показать все результаты (>53) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/nir/papers/NIM_Cyl-Drift-Ch.pdf
• http://lav01.sinp.msu.ru/nir/papers/NIM_CsI-D.pdf

... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

... Dmitry A. Korolkov Ph.D., associate professor, Faculty of Economics and Management, Smolensk Institute of Economy a branch of the St. Petersburg University of Management and Economics. ... Popularization of agritourism as an organized recreational activity is one of the problems to be solved for the establishment and development of agritourism as an independent sector of tourism industry. ... Tourism, agritourism, regional development programs, directions, development of agritourism. ...

Еще в разделе: (Показать все результаты (>305) - ee-journal.spa.msu.ru/ )

Authors are asked to follow the instruction to authors published in the Journal "Phytopathology" (1995, vol.85. No.l, pp.7-10) before submission a manuscript. Here is its concise translation into Russian together with the details required by this journal and those are different from "Phytopathology". Authors are urged to read very carefully all paragraphs of the instruction following below to save much unnecessary work and avoid delay in publication. ... Papers should be in English. ...

Еще в разделе: (Показать все результаты (>211) - herba.msu.ru/ )

• What's new?
• Algologia. Vol.7, No. 3
• Complete flora of islands and lakes as a statistical hypothesis

faq ]] . CompHEP . ... Installation . ... Q: When I try to display squared diagrams for 6 final particles the CompHEP stops . ... Read the FAQ page, . ... Old versions of CompHEP (e.g. 33.23, see the 'Downloads' page) could be installed on HP, SUN and DEC platforms. ... The installation of some versions earlier than 4.4 on 64bit lxplus.cern.ch machines, where 32bit libisajet and libmath from cernlib are found by ./configure in the directory /cern/pro/lib may require the following steps: . ...

Еще в разделе: (Показать все результаты (>23) - comphep.sinp.msu.ru/ )

• downloads [CompHEP]
• overview [CompHEP]
• extra:main [CompHEP]