XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

• Best search engines for finding scientific information in the Internet:

... Boris A. Grishanin is an Associate Professor in the Department of Physics, M.V.Lomonosov Moscow State University (MSU). He received his M.S. and Ph.D. degrees from MSU in 1963 and 1968, respectively (both in Physics). ... B. A.Grishanin's current research interests are in the field of quantum theory of open systems, laser physics, molecular dynamics of photoexcited molecules, problems of quantum information and quantum computing. ... Information theory . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>80) - qilab.phys.msu.ru/ )

... The system is organized as a mixture of two methods: concatenation - on the segment level (using the linguistically motivated units - allophones spliced together to form the synthesized speech wave) and the rule-based method on the prosodic level to modify speech wave created from the allophones according to the prosodic characteristics of the phrase being synthesized. ... Our system takes as an input text any sequence of orthographic words separated by gaps or punctuation marks. ...

Еще в разделе: (Показать все результаты (>385) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/SpeechGroup/publication1/bab_kr_00.doc
• http://www.philol.msu.ru/~otipl/SpeechGroup/publications/web_1.doc
• http://www.philol.msu.ru/~otipl/SpeechGroup/publications/2001/specom01.doc

... 8 OpenFlow , , , , , , NAT, ARP, DNS, DHCP, BGP , , web Ї ґ Ї events per second Ї >10M Ї "" ґ Ї us Ї ґ 24/7 Ї ґ : ґ (2013) Ї Ї Ї Ї Ї Ї Ї Ї Ї NOX-Classic NOX Beacon Floodlight SNAC Ryu POX Maestro Trema Ї Ї Ї Ї Ї Ї Ї Ї Ї Helios FlowER MUL McNettle NodeFlow Onix SOX Kandoo Jaxon Ї Cisco ONE controller Ї Nicira NVP Controller Ї Big Network Controller Ї IBM Programmable Network Controller Ї HP SDN Controller Ї NEC Programmable Flow 11 Ї ґ ґ Ї ґ Ї ґ Ї ґ OpenFlow 12 5/30/2013 13 (2013) Ї 7 000 000 . ...

Еще в разделе: (Показать все результаты (>5) - lvk.cs.msu.su/ )

... Lectures, Questions & Answers . ... Moscow U) . ... I Solid St Chem Mechanochem) . ... Evgeny V. Antipov (Faculty of Chemistry, Moscow State University) New cathode materials for lithium batteries . ... Vladimir I. Feldman (Faculty of Chemistry, Moscow State University) Physics and chemistry of solvated electron . ... Galina A. Tsirlina (Faculty of Chemistry, Moscow State University) Diversity of electrochemistry: the specific problems of molecular models and their experimental verification . ...

Еще в разделе: (Показать все результаты (>32) - www.elch.chem.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... It is necessary to note that a change-point detection method which we applied to a real EEG signal was developed on the basis of the piecewise stationarity model of the signal. ... The data presented in this Chapter demonstrate that the effective detection of the change-points opens the way for a number of new methods of the analysis of complex signals such as the EEG. ...

Еще в разделе: (Показать все результаты (>68) - brain.bio.msu.ru/ )

• Change-points in EEG components with different pattern
• Other prospects of the change-point based analysis
• Analysis of change-point synchronization in multi-channel EEG

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ?GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY? aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>308) - www.geogr.msu.ru/ )

• replica louis vuitton handbags louis vuitton outlet florida 2012 online
• CONTENTS ? 2 - 2012

University Satellites and . Space Science Education . ... Module "Dust" of equipment "Chistota" on research dust vicinity a SC "Photon-M" . ... Module "Dust" is intended for data gathering about characteristics of dust particles in vicinity SC. ... Gauges were combined and made measurement of temperature of a surface of the gauge, fixed presence of a sunlight, registered flying by dust parti-cles in the optical way, measured weight of the adsorbed substance on a surface of the quartz resonator. ...

Еще в разделе: (Показать все результаты (>6706) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University

... Optimization of Long Low-Sized Silted Objects Search at Parametric Survey of Sea Bottom . ... The problem of hydroacoustic location of long low-sized silted objects using parametric means of bottom survey is investigated. ... The questions of low-sized silted objects search using local resonances and also problem of synchronization between resonant formations in bottom structures are discussed. ...

Еще в разделе: (Показать все результаты (>214) - acs366.phys.msu.su/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>4961) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Relational ENSDF
• CDFE provides the major photonuclear databases. Online Services.
• CDFE => Online Services => Nucleus Ground State Parameters

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>16) - ecoinformatica.srcc.msu.ru/ )

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>79) - electr003.chem.msu.ru/ )

• Oleg A. Petrii

... Thus, the development of a method of synthesis of signals of finite duration, optimal in the sense of maximum concentration of energy in specified frequency ranges, is the actual problem. ... Erik Larsen, Ronald M. Aarts, "Audio Bandwidth Extension: Application of Psychoacoustics, Signal Processing and Loudspeaker Design", John Wiley & Sons, ISBN: 0-470-85864-8, September 2004. ... Time-frequency decomposition, 2. ... Shaping of the energy spectrum envelope of high-frequency content, 4. ...

Еще в разделе: (Показать все результаты (>172) - imaging.cmc.msu.ru/ )

• Research | Laboratory of Mathematical Methods of Image Processing
• Ringing analysis - database | Laboratory of Mathematical Methods of Image

LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

Еще в разделе: (Показать все результаты (>4) - www.phys.msu.ru/ )

Russian . ... Projects . ... FADR conducts activities in (the) two general fields: information support for agribusiness and farmers, and the development and implementation of the new educational programms. ... The main focus of the Foundation for Agrarian Development Research (FADR) is the information support to agricultural producers. ... In 2000, the Canadian Agency for International Development regarded the Russian Rural Information Network project the best agricultural project. ...

Еще в разделе: (Показать все результаты (>195) - www.fadr.msu.ru/ )

• SPECIAL ISSUE OF CATENA ?RECONSTRUCTION AND CLIMATIC IMPLICATIONS OF PALEOSOLS?
• IV International Conference on Cryopedology

... Relative equilibria in the problem of triangle and point movement under mutual attraction forces . ... Complete and incomplete exponential systems in the power weighted spaces on a half-line . ... Optimization of the Fobos expedition under control of pulse actions with the use of solutions to the Lambert problem and accounting the Earth and Mars attraction . ... Flatter of elastic strip under longitudinal supersonic flow . ...

Еще в разделе: (Показать все результаты (>222) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Vestnik
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

... Полная версия этой страницы: Software Developer . Студенческий форум Физфака МГУ > Общий > Работа . Anastasiya . ... BroadVision QuickSilver enables you to create and publish lengthy, complex documents in multiple output formats (including HTML, PDF and Postscript) and automates publishing of personalized content to BroadVision Portal. Assemble publications from a variety of text, graphic and database sources, including Microsoft Word, AutoCad, Microsoft Excel, and Oracle. ...

Еще в разделе: (Показать все результаты (>1641) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Работа в Samsung
• Студенческий форум Физфака МГУ > 'Crossed-Field' and 'EH' Antennas
• Студенческий форум Физфака МГУ > DjVu problem

Related papers . ... N. N. Nepeyvoda, Logics and programming's styles (Russian, PDF). ... Abstract. ... D. Levshin Semantic Web and PostgreSQL Integration Algorithms (Russian, PDF). ... We consider Semantic Web and PostrgreSQL DBMS integration. Analysis of known systems for using databases with Semantic Web is performed, PostgreSQL features that can be useful for integration implementation are emphasized, integration methods and algorithms are proposed, and one of these algorithms is implemented. ...

Еще в разделе: (Показать все результаты (>187) - sp.cs.msu.ru/ )

• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry
• DVM debugger. Detailed design
• Development of portable program system

... The Second International Astronomy Olympiad . ... Problems to solve, 8-10 Form Text of these problems is available in Russian too. ... Two stars have the same absolute magnitude. ... The orbital period of Mars is 687 days. ... See problem 2. for 8-10 Form. ... Problem to solve, 9-12 Form Text of the problem is available in Russian too. ... Problem is about Doppler-effect, to find velosities of two stars using their spectra and spectrum of our Sun, to estimate speed of the Earth moving around the Sun...

Еще в разделе: (Показать все результаты (>22) - www.issp.ac.ru/ )

• IO of EAAS, Problems to solve (In Russian)
• II IO of EAAS, Problems to solve (In Russian)
• Institutes of Chernogolovka