... Program . ... Sarancka D. Использование дифференциальных уравнений при моделировании тундрового сообщества . ...

Еще в разделе: (Показать все результаты (>61) - pont2008.cmc.msu.ru/ )

• Program International Conference Differential Equations and Topology dedicated

... Laboratory of Mathematical Methods of Image Processing . ... Image analysis . ... Ringing effect . ... It can be efficiently used as a post-processing method for global image deblurring methods . ... Development of edge width estimation algorithm is important for image enhancement and image quality analysis methods. ... Ringing effect so known as Gibbs phenomenon in mathematical methods of image processing is the annoying effect in images and video appeared as rippling artifact near sharp edges. ...

Еще в разделе: (Показать все результаты (>595) - imaging.cmc.msu.ru/ )

• Computer Tomography image filtering | Laboratory of Mathematical Methods of
• Image resampling and superresolution | Laboratory of Mathematical Methods of
• View publication | Laboratory of Mathematical Methods of Image Processing

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Scientific directions . ... The research of the department of General Problems of Control has taken four major directions, each of which has several branches. ... general Lagrange principle, problems of convex analysis and methods of duality in the theory of extremal problems . ... free-boundary problems . ... Optimization, optimal control, numerical methods and questions of applied mathematics: . ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>143) - new.math.msu.su/ )

• Rozhdestvenskiy Aleksey Valeryevich | Department: General Problems of Control.
• Osipenko Konstantin Yuryevich | Department: General Problems of Control.
• Contacts | Department: General Problems of Control. Faculty of Mechanics and

... Consider the problem of exchanging one dollar into cents, which could be formulated in the following way: How many are the different solutions of the Diophantine equation 100 = x1 + 2 x2 + 5 x3 + 10 x4 + 20 x5 + 50 x6 , where x1, ..., x6 are unknowns, taking non negative integer values? ... A corresponding programming language which is appropriate of using by secondary students should answer to several criteria. ... One could apply the programming language PHP to solve the above mentioned problem. ...

Еще в разделе: (Показать все результаты (>500) - chem.msu.ru/ )

• Entrance Examinations - Main Round
• Entrance Examinations - Preliminary Round
• Moscow University Chemistry Bulletin Vol. 42, No. 4, P. 241 (2001)

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... During the round table, NAMMI and Lomonosov Moscow State University were represented by Sergey Smirnov, associate professor of the Faculty of Journalism of Lomonosov Moscow State University. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>170) - www.journ.msu.ru/ )

• Full-time programs :: Department of Journalism, M. V. Lomonosov Moscow State

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>124) - www.rochesterastronomy.org/ )

... For those who is interested in thermodynamic modeling . Yuri Shvarov . This page is aimed mainly at the users of the software package HCh for thermodynamic (equilibrium) modeling of (geo)chemical systems and processes. However, some files presented here may also be of some interest to those who do not use HCh. ... HCh for DOS . ... User's guide for the Unitherm program intended for maintaining thermodynamic databases and calculation of thermodynamic properties of substances . ...

Еще в разделе: (Показать все результаты (>91) - www.geol.msu.ru/ )

• Near-surface electrical prospecting laboratory at Moscow University
• Software for resistivity and induced polarization
• Faculty of Geology >> Geology at Moscow State University

... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...

Еще в разделе: (Показать все результаты (>2) - icho39.chem.msu.ru/ )

О факультете . ... Социологические школы и олимпиады . ... Вестник МГУ . ... МГУ, д. 1. стр. ... English version . ... Programs for foreign students . ... Contacts Faculty of Sociology was founded on June 6, 1989. ... Hence the faculty offers the best educational programs to meet the needs of international students and requirements of contemporary sociology and employment standards in today?s dynamic and changing world. ... PhD programs The faculty provides studies for bachelor's degree in Sociology. ...

Еще в разделе: (Показать все результаты (>76) - www.socio.msu.ru/ )

... List Of Participants . ... 8:00-10:30 Educational Lectures for the students UlSU and UISS young participants . ... 17:30 Cultural program (excursions along Ulyanovsk historical part, etc) . For September 16-17 culture program is planed. It includes walk to the wonderful place-forest on Volga bank, trip along Volga, etc. ...

Еще в разделе: (Показать все результаты (>589) - xray.sai.msu.ru/ )

• No Title
• Tsiolkovskii's Paradox
• Scenario Machine Engine: Credits

... Department . ... Courses . ... Course Name . ... Prof. Fedor S. Zaitsev . ... Prof. Alexander M. Popov . Visualization in Scientific Research . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Vladimir V. Nefedov . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Prof. Alexander P. Smirnov . Two-Dimensional Problems of Mathematical Physics . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>18) - ani.cmc.msu.ru/ )

• Courses
• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the
• The ASR Department at the CMC Faculty of Lomonosov MSU

... Inside the computer's microprocessor chip, a clock distribution system delivers the timing signals from the crystal oscillator to the various circuits, just as sound in air delivers the beat of a drum to soldiers to set their marching pace. ... Beat the Clock . ... Now researchers are designing asynchronous systems that can process data without the need for a governing clock. ... Without a clock to govern its actions, an asynchronous system must rely on local coordination circuits instead. ...

Еще в разделе: (Показать все результаты (>497) - chronos.msu.ru/ )

• Russian Interdisciplinary Temporology Seminar
• O.S.Razumovsky. Models of Time in Physics and Cosmology
• Laboratory-Division Quantum Electrodynamics of Self-Organizing Systems and

All these programs are written on FORTRAN 77. ... Listing of the main routine, the function and the results ( fig4_2.txt ). Listing of the subroutines ( listing_01.txt , listing_01.zip ). ... The block (the main routine, the function and the subroutines (+general)). ( application_01.zip ). ... General programs. ... All listings of the subroutines ( all_listings.zip , all_listings.txt ) and the main routines with the functions and the results ( all_figures.zip , all_figures.txt ). ...

Еще в разделе: (Показать все результаты (>42) - foroff.phys.msu.ru/ )

• Faculty's Tuition Structure
• Postdoctoral training (General Physics and Wave Processes)
• Key research directions

Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...

Еще в разделе: (Показать все результаты (>6) - statsoft.msu.ru/ )

• InCo Service In English

... Development of a computer-based information system for Russian folklore studies . Computer systems SKAZKA and SKAZKA-2 are developing by A.V. Rafaeva. The aim of this work is to make program tools for structural analysis of folktale plots and motives. ... 112 – 113; Rafaeva A.V. Analiz rodstvennykh otnoshenij s pomosh’ju sistemy SKAZKA (Analysis of Relate Terms with the Help of SKAZKA Program) // Problemy kompjuternoj lingvistiki: Sbornik nauchnykh trudov, 1. ...

Еще в разделе: (Показать все результаты (>39) - lcl.srcc.msu.ru/ )

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>5) - composite.msu.ru/ )

... Second-year students classes . ... The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... As a result, by the and this course, students acquire knowledge about the popular parallel programming techniques, knowledge of modern high-performance computing systems and practical skills to work with them. ... Moscow: Binom...

Еще в разделе: (Показать все результаты (>61) - engineering.phys.msu.ru/ )

• Introduction to Linux

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...

Еще в разделе: (Показать все результаты (>22) - astrometric.sai.msu.ru/ )

• Computer....