... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>19) - lcc.chem.msu.ru/ )

• CV of Alexander Moskovsky

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Требуется Senior Embedded Software Engineer в компанию Isilon. ... Engineering or Computer Science degree.  5+ years of real-time embedded systems programming experience. ...

Еще в разделе: (Показать все результаты (>5139) - www.snto-msu.net/ )

• Re: Новинки программного обеспечения - Public forum of MSU united student
• For sale: AMD AM2 4000+ based computer + Asus flat display 22" - Public forum
• The Windows product key installed on this computer is not genuine - Public

The COMAGMAT model is a series of linked programs developed to calculate phase equilibria for dry and hydrous natural magmas crystallizing in the range of pressures from 1 atm to 10-12 kbar and including both open (12 oxygen buffers) and closed system fractionation with respect to oxygen. ... Moreover, COMAGMAT allows the user to simulate behaviour of 20 trace elements, including Mn, Ni, Co, Cr, V, Sc, Sr, Ba, Rb, Cu, and REE. ...

Еще в разделе: (Показать все результаты (>571) - geo.web.ru/ )

• Авторский сайт Владимира Мальцева - литература
• Differentiated Sills

... Course "Computer Physics" for 1st and 2nd year students of Physics . ... The audience is 1st and 2nd year students of Physics. ... It consists of a short lecture course, seminars, and a large number of computer labs. ... 1985-1994 : Lectured a specialized course on "Computer Physics"for the 3rd year students of Physics, Department of Physics, and attendees of the continuing education department, International Laser Center of Moscow State University. ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>80) - qilab.phys.msu.ru/ )

... Lynn : Presto RIP 13.02.2013 13:26 | ... http://www.opera.com/press/releases/2013/02/13/ . ... To provide a leading browser on Android and iOS, this year Opera will make a gradual transition to the WebKit engine, as well as Chromium, for most of its upcoming versions of browsers for smartphones and computers. The WebKit engine is already very good, and we aim to take part in making it even better. ... Имхо, главная новость тут не RIP Presto а торжество Open Source в лице WebKit! . ...

Еще в разделе: (Показать все результаты (>8511) - www.fds-net.ru/ )

• MICROSOFT OFFICE 2007 BETA (HAS EXPIRED!!!!) - Public forum of MSU united
• Computer Browser - Public forum of MSU united student networks
• Программисты шутят - Public forum of MSU united student networks

... Measurement of the MASS detectors parameters with mass program January 24, 2015 [112707] . MASS/DIMM electronics. ... Turbina-core(D): Dimm User Guide. ... N.Shatsky, V.Kornilov, The revision of the MASS/DIMM star catalogue. ... О.Возякова, В.Корнилов, Н.Шатский, Новое программное обеспечение прибора MASS/DIMM. ... V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site. ...

Еще в разделе: (Показать все результаты (>28) - curl.sai.msu.ru/ )

• atmos 3.0 page

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Вакансии . ... Learning and Understanding HP and 3rd party software solutions, including architectures, development practices, frameworks, methodologies, SDK's, additional programming languages and tools as necessary, etc . ... Development of test plan, unit tests, integration, system and acceptance tests, basing on functional specification and user requirements, architectures, development schedules and project plans . ...

Еще в разделе: (Показать все результаты (>184) - www.physcareer.ru/ )

• Software Engineer (C/C++ and JAVA) / Вакансии / Physcareer.ru
• HP Graduate Development Program 2010 / Вакансии / Physcareer.ru
• Software Engineer (Server) / Вакансии / Physcareer.ru

... The 6th Moscow International Conference on Operation Research (ORM-2010) was held on 19-23 of October 2010 in Moscow. ORM is a triennal conference organized by Dorodnicyn Computing Center of the Russian Academy of Sciences (RAS), Lomonosov Moscow State University and Russian Scientific Operation Research Society. ... A. Vasin was optimistic about the further integration of the Russian of the Russian OR community as he himself is already actively involved in conferences of GOR, EURO and IFORS. ...

Еще в разделе: (Показать все результаты (>28) - io.cmc.msu.ru/ )

Алексеевский Андрей Владимирович . ... Миронов Андрей Александрович . ... Тем не менее, посещение страницы "Тьюторы ФББ" может быть полезным для выбора тьютора . ... Для студентов 1-го курса: Можно начать поиски тьютора уже сейчас! ... Активность в выборе темы и руководителя - за студентом. Студент выбирает руководителя и тему, просит руководителя взять его на данную тему. ... Студент сообщает о договоренности (фамилии студента и тьютора, название темы) Л.А.Зиновкиной . ...

Еще в разделе: (Показать все результаты (>6334) - kodomo.cmm.msu.ru/ )

• TracFineGrainedPermissions тАУ Tanchiki

О кафедре . Сотрудники . ... Публикуем материалы сотрудников кафедры . ... Кафедра математических и компьютерных методов анализа создана приказом ректора МГУ в 2008 году. ... Сотрудники кафедры проводят научные исследования в следующих областях: аналитическая теория чисел, математический анализ, теоретико-числовые методы в криптографии, сложность вычислений, компьютерная криптография, компьютерная геофизика. ... 2016, Кафедра математических и компьютерных методов анализа. ...

Еще в разделе: (Показать все результаты (>2) - mkma.math.msu.su/ )

... Development of a computer-based information system for Russian folklore studies . Computer systems SKAZKA and SKAZKA-2 are developing by A.V. Rafaeva. The aim of this work is to make program tools for structural analysis of folktale plots and motives. ... 112 – 113; Rafaeva A.V. Analiz rodstvennykh otnoshenij s pomosh’ju sistemy SKAZKA (Analysis of Relate Terms with the Help of SKAZKA Program) // Problemy kompjuternoj lingvistiki: Sbornik nauchnykh trudov, 1. ...

Еще в разделе: (Показать все результаты (>38) - lcl.srcc.msu.ru/ )

make_codepage - Construct a codepage file for Samba . ... In the ' c ' case this will be a text codepage definition file such as the ones found in the Samba source/codepages directory. ... A text Samba codepage definition file is a description that tells Samba how to map from upper to lower case for characters greater than ascii 127 in the specified DOS code page. ... Users are encouraged to write text codepage definition files for their own code pages and donate them to samba-bugs@samba.org . ...

Еще в разделе: (Показать все результаты (>879) - oit.cmc.msu.ru/ )

• Apache module mod_imap
• Error Control Operators
• Unix/Mac OS X installs

... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• TernAPI program Laboratory of Chemical Thermodynamics

Home People Activities Research Publications . ... Containers for image storage in memory, reading and writing of image files, Pipeline filtering library, D.Yurin "On the Images Pipe Line Filtering, PDF , color spaces, fast convolutions, image registration algorithms, edge curvature estimation via differential invariants (under development) , Bresenham algorithms, some numerical algorithms etc. ... Download help on project (CHM) , generated via doxygen (see How to document program's code ) . ...

Еще в разделе: (Показать все результаты (>21) - imaging.cs.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>414) - xray.sai.msu.ru/ )

• No Title
• Computer experiments in Astrophysics
• Bookmarks for Mikhail E. Prokhorov

Galina K. Vasilyeva , PhD, senior researcher at the Institute of Physical Chemical and Biological Problems in Soil Science, Russian Academy of Sciences (IPBPSS RAS), head of group of soil bioremediation. Tel. (of.) 096) 773-3830. ... Participant of Russian-American exchange programs: 1. ... Nadezhda D. Anan'eva , PhD, Chief of the Laboratory of soil microbiology at the Institute of Physical Chemical and Biological Problems in Soil Science, Russian Academy of Sciences (IPBPSS RAS). ...

Еще в разделе: (Показать все результаты (>185) - www.prof.msu.ru/ )

• Vladimir Iakimets
• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS

COMPUTER DESIGN OF HETEROCYCLIC RING-OPENING REACTIONS. ... Since the cleavage of ring bond requires appearance of new bond either between th e (endo) atoms of initial cycle, or between initial cycle and external (exo) group, the first case is treated as endoopening, and the another as exo-opening: Endo-Ring Opening Exo-Ring Opening © 1995 American Institute of Physics 75 7 758 Heterocyclic Ring-Opening Reactions General Methodology and Algorithms 1. ... RULE FOR ENDO-TYPE RJNG OPENING. ...

Еще в разделе: (Показать все результаты (>155) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/032e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/028e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/041e.pdf

... 2) to undertake multuaspectual reseach of textual and dictionary data using developing software, including combination and comparison of various classifications of textual and dictionary elements of Natural Language. Up to now in majority of cases systems for text processing, on the one hand, and systems for accumulation and analysis of dictionary data, on the other, are elaborated separately. ... It provides a user with ability to control and analyse some textual data. ...

Еще в разделе: (Показать все результаты (>72) - old.philol.msu.ru/ )

• MSU-LGCLL:: Main Page
• MSU-LGCLL:: Papers submitted to QUALICO-94

This module provides for server-side imagemap processing. ... Configurable generation of imagemap menus. The lines in the imagemap files can have one of several formats: directive value [x,y ...] . ... The directives can come in any order, but are processed in the order they are found in the imagemap file. base Directive . ... Module: mod_imap . ... Its value is overridden by a default directive within the imagemap file. ... Its value is overridden by a base directive within the imagemap file. ...

Еще в разделе: (Показать все результаты (>121) - neptun.sai.msu.ru/ )

• Apache Tutorials
• Apache HTTP Server Version 1.3 Documentation
• Apache HTTP Server and Supporting Programs

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>26) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search