... Contact information . ... microsoft.cs.msu.su . ... Our goal is to provide researchers from many branches of science, education and industry with innovative tools and methods for solving applied problems using the latest information technologies, modern methods of computation modeling and scientific visualization. ... FetchClimate is deployed as a Windows Azure cloud service. ... The uncertainty can be used in further uncertainty estimation of a computational model that uses FetchClimate. ...

Еще в разделе: (Показать все результаты (>166) - en.cs.msu.ru/ )

• Research Laboratory of Computational Modeling Tools | CMC MSU
• Laboratory of Programming Technologies
• Department of System Programming | CMC MSU

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

. This document is designed to be viewed using the frames feature. If you see this message, you are using a non-frame-capable web client. Link to Non-frame version.

Еще в разделе: (Показать все результаты (>50) - angel.cs.msu.su/ )

• : Class NetcdfFile
• NetCDF User's Guide for C
• : Class ConcreteIndexMap

. The Camtasia Studio video content presented here requires JavaScript to be enabled and the latest version of the Macromedia Flash Player. If you are you using a browser with JavaScript disabled please enable it now. Otherwise, please update your version of the free Flash Player by downloading here . 2006-2010 Автор инструкции Миняйлов В.В. 2006-2010 Химический факультет МГУ имени М.В. Ломоносова .

Еще в разделе: (Показать все результаты (>34) - do.chem.msu.ru/ )

... Ph.D., assistant professor, School of Public Administration, Lomonosov Moscow State University. ... The author reviews the published proceedings of the Internet-conference organized in April, 2012 by the Human Resources Management Department, School of Public Administration, Lomonosov Moscow State University. ... Conference, management of human resources, efficiency of HRM programs in Russia. ... Public Administrarion". 119991, Room A-710, Shuvalovskiy building, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>188) - ee-journal.spa.msu.ru/ )

... Seminar archive . ... The structure of the X-ray sources in the hard spectral state of accreting black-hole binaries has been a subject of intense debate. The paradigm dominant for many years postulated that the accretion disc in the hard state is truncated at some radius >> the innermost stable orbit (ISCO) whereas the disc reaches the ISCO in the soft state. ... On the other hand, there have been numerous claims in recent years that the disc extends to the ISCO in the hard state. ...

Еще в разделе: (Показать все результаты (>24) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory

Lomonosov project . ... Scientific goals . ... Gamma-bursts . ... Scientific equipment . ... BDRG . ... ShOK . ... Information unit (BI) . ... Three complexes of scientific equipment onboard ?Lomonosov? satellite will provide multi-wave measurements of gamma-bursts , which are necessary for the studies of the nature of these astrophysical sources. These complexes are BDRG, ShOK and UFFO providing gamma-bursts? measurements within optics, gamma, X-ray and UV-ranges of electromagnetic spectrum. ...

Еще в разделе: (Показать все результаты (>12) - lomonosov.sinp.msu.ru/ )

МГУ имени М.В.Ломоносова Русская версия . ... Chairman - Professor Dmitry G. Koshchug, Dean of Graduate School of Innovative Business . Vice-Chairman - Sergey Karev, Graduate School of Innovative Business, Associate Professor. ... Gvozdanny Vyacheslav Afanasievich - head of the Master Degree programm in Management at Graduate School of Innovative Business, Associate Professor; . ... Section "Innovative nature resource management" was organized in 2008 by the Graduate School of Innovative Business. ...

Еще в разделе: (Показать все результаты (>327) - conf.msu.ru/ )

• Главная / МГУ имени М.В.Ломоносова
• Talantbek Amanovich Sapitov / МГУ имени М.В.Ломоносова
• Inessa Владимировна Steklova / МГУ имени М.В.Ломоносова

... Инновационная . структура МГУ . ... Обучение инновационному менеджменту . ... Нормативно-правовая база инновационной . деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... J.L. Nesheim, High Tech Start Up: The complete how-to handbook for creating successful new high tech companies, ISBN 0-914405-71-3. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>54) - innovation.msu.ru/ )

. Moscow State University Belozersky Institute of Physico-Chemical Biology . English version Russian version . Web-design by Sergei Golyshev .

Еще в разделе: (Показать все результаты (>3) - cellbiol.genebee.msu.ru/ )

... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>8) - erp.cmc.msu.ru/ )

... There are different techniques available that may be used to achieve an effect of focusing of acoustic energy. ... Although such type of array is known, there are comparatively little available experimental data concerning the radiation of finite amplitude wave by it. The aim of the paper is to present results of examination, both experimental and numerical, of the pressure field of the arrays composed of axisymmetric areas of different structure radiating the finite amplitude wave. ...

Еще в разделе: (Показать все результаты (>150) - acs366.phys.msu.su/ )

• Abstract (Invited)

... Master Education . Second Education . ... Thu, 03/27/2008 - 17:33 ? zavuch . ... Внимание студентов 2-го курса , обучающихся по магистерским программам "Открытые информационные системы" и "Программное обеспечение вычислительных сетей". 8 апреля в 18.00 в ауд.371 состоится отчет о НИР . ... Wed, 12/19/2007 - 19:48 ? ... Thu, 12/13/2007 - 18:24 ? ... Запись у Малиновской О.А. Thu, 12/06/2007 - 21:48 ? ... Второе высшее образование: second_edu@cs.msu.ru, 6-й этаж, комната 640, тел. ...

Еще в разделе: (Показать все результаты (>24) - hcs.cmc.msu.ru/ )

• Blogs | Магистерское и послевузовское образование

... Robert Hermann Brookline, MA (Received November 22, 1999) der to illustrate the obvious progress, one can mention a variety of examples. ... In or- FYI Item "BMS Report on Institutes" As a member of the panel commissioned by the Board on Mathematical Sciences of the National Research Council, I write to correct several inaccuracies in the "For your information" note by Allyn Jackson entitled "BMS Report on Institutes" in the December 1999 issue of the Notices. ...

Еще в разделе: (Показать все результаты (>62) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/CHAOS_DNA.pdf

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>36) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/h2020presentationRU.pdf
• http://ideas.msu.ru/news/03_08_2011_Russia.pdf
• http://ideas.msu.ru/docs/CSA_guide_2008.pdf

... X-COM: Distributed Computing Software . ... The idea of distributed computing, or metacomputing, is to combine available computational resources for different applications processing. ... For these applications we simultaneously used high-performance computational resources of Moscow State University and Russian Academy of Sciences, computing centers of Saint Petersburg, Novosibirsk, Chelyabinsk, Ufa, Tomsk, etc. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• APPLICATIONS: Plasma Physics | Moscow University Supercomputing Center
• CLEO: USER & ADMIN-FRIENDLY CLUSTER BATCH SYSTEM | Moscow University
• Octotron: Active Control for Reliable Functioning of Supercomputers | Moscow

... B Design and developmentof a new vacuum chamber for the tests of Q-factors in suspension's modes . ... E New SQL free principle of coordinate monitoring of the test mass . F Appendix I . ... The achieved p new resolution 2 10;11cm= Hz was su cient to record Brownian vibration with relative accuracy better than 10% (see details in Appendix I). ... See details in Appendix IV) E. New SQL free principle of coordinate monitoring of the test mass The new concept of quantum measurement | ...

Еще в разделе: (Показать все результаты (>102) - hbar.phys.msu.ru/ )

• ANCIENT AND EARLY MEDIEVAL ECLIPSES IN EUROPEAN SOURCES
• Autobiography of Joseph Scaliger
• articles on ancient observations

. GO TO THE ENGLISH VERSION . Камерный оркестр МГУ . основан в 1967 г. Эдуардом Гиндиным . художественный руководитель - Александр Константинов . Об оркестре . СОСТАВ: . C езон 20 1 5/20 1 6 . Наши выпускники . ВЫСТУПЛЕНИЯ: . Расписание концертов . Наши аудио - и видео записи . Оперы и кантаты по-русски (перевод Андрея Шарапова) . Другие интересные сайты . Администратор сайта Наталья Ацаркина ( azarkina@ yahoo.com ) . Сайт организован в сентябре 1999 г . Дата последнего обновления : 22 марта 20 16 г .

Еще в разделе: (Показать все результаты (>23) - music.genebee.msu.ru/ )

• H. Purcell: Ode for Queen Mary
• Музыкальная мастерская Эдуарда Гиндина.
• Concerto МГУ.

Общее . ... Геология в Московском университете . ... Профком геологического факультета . ... Геологический факультет МГУ всемирно известный учебно-научный центр России. ... Вся деятельность сотрудников факультета направлена на развитие геологической науки, образования и культуры необходимых условий экономического и духовного возрождения России. ... 119991, Российская Федерация, Москва, ГСП-1, Ленинские горы, Московский государственный университет имени М.В. Ломоносова, Геологический факультет, . ...

Еще в разделе: (Показать все результаты (>151) - geol.msu.ru/ )

• Геологический факультет МГУ >> Студенту и аспиранту
• Геологический факультет МГУ >> Школьнику и абитуриенту День открытых дверей
• Геологический факультет МГУ >> Новости

Tsunami Formation as a Result of Resonant Pumping of Energy into the Compressible Water Column Mikhail Nosov1, Sergey Kolesov1, Andrey Babeyko2, and Rongjiang Wang2 (1) M.V. Lomonosov Moscow State University, Faculty of Physics, Moscow, Russian Federation (m.a.nosov@mail.ru) (2) Deutsches GeoForschungsZentrum GFZ, Telegrafenberg, 14473 Potsdam, Germany (babeyko@gfz-potsdam.de) Strong bottom earthquakes that excite gravitational tsunami waves give rise to hydroacoustic waves as well. ...

Еще в разделе: (Показать все результаты (>18) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/science/nosov/EGU2011_tsunami%20vs%20eq.pdf