О лаборатории . ... Лаборатория теоретической биофизики . Published in Февраль 8th, 2016 . Posted by comcon1 in Без рубрики . ... ERG group members work with different types of molecules and consequently added new atomtypes into classical OPLS-AA distributed with GROMACS. Now the ERG patch of OPLS-AA force field is published at bitbucket as a repository. continue reading.. ... Published in Май 19th, 2015 . ... comcon1 in All-atom automatic OPLS-AA topology? . ... 2014 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>59) - erg.biophys.msu.ru/ )

• OPLS-AA patch for different types of molecules ERG Research Group: Лаборатория
• Python script for processing FRAP image set ERG Research Group: Лаборатория

INTERNATIONAL CONFERENCE "COGNITIVE MODELING IN LINGUISTICS" CML-2011, Corfu (Greece) EXTENDED ABSTRACT SUBMISSION FORM 1. ... General Topics Cognitive Models of La nguage Phenomena For mal Models in Language a nd Cognition Cognitively-Oriented Applications a nd Resources Computer Linguistic 2. ... THE TITLE OF THE REPORT, TIMES NEW ROMAN, 12, BOLD, CENTERED 2 3 One blank line. List of authors, Times New Roman, 12, bold, centered 4 One blank line. ... One blank line. ...

Еще в разделе: (Показать все результаты (>295) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/fdsl/abstracts/romanova.pdf
• LangueDOC :: Movie
• Московское типологическое общество :: МГУ :: Филфак :: ОТиПЛ

. Портал | Содержание | О нас | Авторам | Новости | Первая десятка | Дискуссионный клуб | Научный форум | Отправить открытку . Первая десятка "Русского переплета" Темы дня: . | Обращение к Дмитрию Олеговичу Рогозину по теме "космические угрозы": как сделать систему предупреждения? .

Еще в разделе: (Показать все результаты (>155) - www.pereplet.ru/ )

• Super Ratio

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>78) - scon155.phys.msu.su/ )

• Off-center impurities

... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>20) - www.students.chemport.ru/ )

... Class . ... Provides an abstraction for multidimensional array access, some concrete implementations, and ways to view a MultiArray as if it had a different structure. ... This interface defines the services required by MultiArrayProxy to manipulate indexes and the dimensions of a MultiArray. ... In the following, we use the unadorned term "array" to mean the Java language construct, and the term "multidimensional array" for the mathematical abstraction modeled by the MultiArray class in this...

Еще в разделе: (Показать все результаты (>50) - angel.cs.msu.su/ )

• Summary
• : Class ConcreteIndexMap

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Listing available drive partitions . ... about partitions. ... Re: Listing available drive partitions [ re: BlackCode ] . ... Re: Listing available drive partitions [ re: l0st ] ...

Еще в разделе: (Показать все результаты (>2450) - www.snto-msu.net/ )

• Проблемы с MSDN, что c VS2005 Feb CTP - Public forum of MSU united student
• Новинки программного обеспечения - Public forum of MSU united student networks
• Re: Новинки программного обеспечения - Public forum of MSU united student

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... University of Groningen, The Netherlands . PhD Position available . ... PhD Position in Theoretical Chemistry . ... She is considered to be one of top 5 universities in Europe for research in Materials Science, Chemistry, Space Science, Microbiology, and Environment/Ecology. ... In 1993, the MSCplus was accredited by the Royal Netherlands Academy of Arts and Sciences (KNAW) as a leading Research School in Materials Science. ...

Еще в разделе: (Показать все результаты (>95) - www.physcareer.ru/ )

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>25) - observ.pereplet.ru/ )

• MASTER : List of HAZARDOUS ASTEROIDS (PHA) and COMETS discovered by MASTER

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

Еще в разделе: (Показать все результаты (>10) - www.sciencepark.ru/ )

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>25) - comphep.sinp.msu.ru/ )

• faq [CompHEP]

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Now upon my arrival home after staying for four months in America I've realized how much I miss that country. ... The famous American smile was on every face. ... Can you imagine our shop assistant, who thanks you with a charming smile and wishes you a good day even if you didn't buy anything? ... People greet each other every time they meet, even if they parted only a few minutes ago. ... I was lucky to be placed at the University of Pennsylvania, the oldest American university. ...

Еще в разделе: (Показать все результаты (>137) - www.prof.msu.ru/ )

• Eleven years of independence
• Central Eurasian Studies Society Sixth Annual Conference (2005)
• One effective method to turn passive students into active learners in Russian

... Grant of Ministry of Science and Techologies of Russian Federation, subprogram "Engineering enzymology . ... The development of fundamentals and technology of sulfur removal from gas and waste water streams by immobilyzed biocatalytic systems . ... Grant of Ministry of Science and Technologies of Russian Federation subprogram "Biocatalytic technologies " . Ministry of Science and Technologies of Russian Federation . ... Grant of Ministry of Science and Technologies of Russian Federation . ...

Еще в разделе: (Показать все результаты (>126) - www.enzyme.chem.msu.ru/ )

... We obtained 20 complete cytochrome b sequences (1140 bp) of Meles leucurus from the Korean Peninsula (mainland Korea and Jeju Island), Russian Far East, and Mongolia, and these sequences were compared to complete and partial (629 bp) sequences of M. leucurus , obtained from GenBank, in order to reexamine genetic differentiation among M. leucurus from Korea, Siberian and Far-eastern Russia, Mongolia, and China. ...

Еще в разделе: (Показать все результаты (>1311) - zmmu.msu.ru/ )

• Global fossil bat records - abstract
• Regional zoogeographical zoning using species distribution modelling by the

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>3) - saistud.sai.msu.ru/ )

... Accretionary soil: a thick soil formed by simultaneous slow deposition of sediment and pedogenesis; it may possess an over-thickened A horizon which grades up into overlying unaltered sediment, or an "endless B horizon" formed as the basal A horizon is progressively transformed into B horizon material (synonym: cumulic soil). ... Minor episodes of deposition may have occurred between or within the periods of soil development, but were not sufficient to leave layers of unaltered material. ...

Еще в разделе: (Показать все результаты (>503) - www.fadr.msu.ru/ )

• the paleopedology working group had a conference last year in Mexico on "Global
• THE ALBANIAN AGRICULTURAL SECTOR IN TRANSITION
• Abstracts

... A - cellular quotas of algocoenosis components and boundaries and of strata in resources space generated by quotas. B - belonging of nutrient media in the five experiments to different strata, in which community growth is restricted by different submultiplicities of available set of resources. ... Environmental content of resources (mg/l) . Limiting resources . ...

Еще в разделе: (Показать все результаты (>385) - chronos.msu.ru/ )

• NON-STANDARD ANALYSIS OF NON-CLASSICAL MOTION
• Rosolino Buccheri. Time and the dichotomy subjective/objective. An

... My research topic is application of the theory of dynamical systems to models of excitable media. ... One of the remarkable examples of an excitable medium is heart tissue. ... We have observed dynamics of phase singularities using some of the techniques for PS detection on the base of just one framework three-variable Fenton-Karma model with different parameters sets to reproduce various mechanisms of spiral wave breakup which in principle can occur in cardiac tissue. ...

Еще в разделе: (Показать все результаты (>349) - polly.phys.msu.ru/ )

• PSMTLab - Polymers on surface
• NATO Scientific & Environmental Affairs
• NATO Scientific Environmental Affairs

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>137) - hist.msu.ru/ )

• "Novaya i noveishaia istoria" Journal